Dataset for CDS classical BH3-containing proteins of organism Meleagris gallopavo

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|A0A803YBD7_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Meleagris gallopavo GN=BMF (length=546 residues).
atggatcgccccagctacctggaagaggactattctagcctggatgggctggacgatgacgtgtttcactctgatgactt
tggacttgcaggtcagcctggtgagatgactgcaactggcattttcacacagaaccagtcctacagctgccttctgggga
ggtttcaactatttcccctcacacactgctgtggtcccggtgtcaggcatcctgagcagcaggacaaggcaactcaaaca
ctcagcccgtcctcttccaagccccggagactcttctatgggaatgctggttaccgcttacatgtccccccagttggctt
tgcattggatccaaatctccaagaagagcctcaggaaggtcagcgggaggcgcgtactgaggtgcagattgcacggaagt
tgcagtgcattgcagaccagttccaccggctccacatacagcggcatcagcagaacagaaatcaagtgtggtggcagctt
tttctctttctacacaacttggccttaaatgtggaggcgaacaggaaccgcactgggcagaggtga
>gnl|bcl2dbcds|A0A803YBD7_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Meleagris gallopavo GN=BMF (length=357 residues).
atggatcgccccagctacctggaagaggactattctagcctggatgggctggacgatgacgtgtttcactctgatgactt
tggacttgcagggaatgctggttaccgcttacatgtccccccagttggctttgcattggatccaaatctccaagaagagc
ctcaggaaggtcagcgggaggcgcgtactgaggtgcagattgcacggaagttgcagtgcattgcagaccagttccaccgg
ctccacatacagcggcatcagcagaacagaaatcaagtgtggtggcagctttttctctttctacacaacttggccttaaa
tgtggaggcgaacaggaaccgcactgggcagaggtga
>gnl|bcl2dbcds|A0A803YIP1_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Meleagris gallopavo GN=PMAIP1 (length=186 residues).
ttatctggaaaagacctcgttagaattaaatccccatcgccctgcgcgtgttctgcagagcgggacgcggtggctgagtg
cgcactggagctgcgcaagatcggcgacaaggcggacctacagcagaaagtcctgaacctcatcgcgaaacttttctgcc
ccaagaaaccgcgcccgcggtgctga
>gnl|bcl2dbcds|G1MV54_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Meleagris gallopavo GN=BCL2L11 (length=399 residues).
gggatgaaaagtcccgaagtttgctctgagtgcactttagccaacactggtacaaggctgcagcatgcacatcgcacggc
cagtcttgattttgttcctgtttccaacgctctgtttttgctctgtgcagcttccaggtggcgatctcactcacttgcag
aagaaatacaaccagaaatatggattgcacaggagctgcggcgcatcggggatgaattcaatgcctcctattctctcccc
agattgggtgcctgtcctgatgctgccccgcatccactcttgcctctgctctctcaccagctcattctttttgagttcat
atgtttttctcctgctctggagtcagcagcttcccttgtggatttgctcgttttccctccctgctgctcacgtgggtga
© 1998-2022Legal notice