Dataset for CDS PMAIP1 of organism Marmota marmota marmota

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C5YUG6_PMAIP1-      atgcctggaaagaaggggtggaagaatgagc---agctgaccccagtgac
A0A8C6A7B1_PMAIP1-      atgcctggaaagaaagtgagtaagcatgcactcaacccaacacaggtgtc
                        ************** * * * *** ***  *   * *  ** *  *** *

A0A8C5YUG6_PMAIP1-      cccagcagtggaacttgagtctggcat---tcaactcaggagatttggag
A0A8C6A7B1_PMAIP1-      agcagaggttgaaactgag---ggcatgtctcaactcaggagatttggag
                          ***  ** ***  ****   *****   ********************

A0A8C5YUG6_PMAIP1-      acaaagtaaatttccgtcagaaacttctgaatttgatttccaaactcttc
A0A8C6A7B1_PMAIP1-      ataaactgaatttccataagaaacttctgaatttgattttcagacccttc
                        * *** * ******* * ********************* ** ** ****

A0A8C5YUG6_PMAIP1-      agtttagtaacctga
A0A8C6A7B1_PMAIP1-      agt---------tga
                        ***         ***

© 1998-2022Legal notice