Dataset for CDS PMAIP1 of organism Marmota marmota marmota

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A8C5YUG6_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Marmota marmota marmota GN=PMAIP1 (length=159 residues).
atgcctggaaagaaggggtggaagaatgagcagctgaccccagtgaccccagcagtggaacttgagtctggcattcaact
caggagatttggagacaaagtaaatttccgtcagaaacttctgaatttgatttccaaactcttcagtttagtaacctga
>gnl|bcl2dbcds|A0A8C6A7B1_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Marmota marmota marmota GN=PMAIP1 (length=153 residues).
atgcctggaaagaaagtgagtaagcatgcactcaacccaacacaggtgtcagcagaggttgaaactgagggcatgtctca
actcaggagatttggagataaactgaatttccataagaaacttctgaatttgattttcagacccttcagttga
© 1998-2022Legal notice