Dataset for CDS BCL2L11 of organism Macaca mulatta

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


F7HHA1_BCL2L11-03      atgttcccggcggctgcggccggggcagcgcgggccagaggcgcggcgtg
F7HHA1_BCL2L11-02      atgttcccggcggctgcggccggggcagcgcgggccagaggcgcggcgtg
F7HHA1_BCL2L11-01      --------------------------------------------------
                                                                         

F7HHA1_BCL2L11-03      cggagccctcggctgcccggcggagtgcggcggcgggctggcgggtaggc
F7HHA1_BCL2L11-02      cggagccctcggctgcccggcggagtgcggcggcgggctggcgggtaggc
F7HHA1_BCL2L11-01      --------------------------------------------------
                                                                         

F7HHA1_BCL2L11-03      gcgggctgtgcgctgcgccgggtactctgaacccaagtccagagctttgt
F7HHA1_BCL2L11-02      gcgggctgtgcgctgcgccgggtactctgaacccaagtccagagctttgt
F7HHA1_BCL2L11-01      --------------------------------------------------
                                                                         

F7HHA1_BCL2L11-03      ttcctgcgctgccttcgtggtgacggtcagggggcgccgggtcggcgaag
F7HHA1_BCL2L11-02      ttcctgcgctgccttcgtggtgacggtcagggggcgccgggtcggcgaag
F7HHA1_BCL2L11-01      --------------------------------------------------
                                                                         

F7HHA1_BCL2L11-03      agcgcgggccagacgccccggggcccgggcgcgggcccggacgctacgct
F7HHA1_BCL2L11-02      agcgcgggccagacgccccggggcccgggcgcgggcccggacgctacgct
F7HHA1_BCL2L11-01      --------------------------------------------------
                                                                         

F7HHA1_BCL2L11-03      ctgaagggaaggcgcggacaaaaaaagaccaaatggcaaagcaaccttct
F7HHA1_BCL2L11-02      ctgaagggaaggcgcggacaaaaaaagaccaaatggcaaagcaaccttct
F7HHA1_BCL2L11-01      --------------------------------atggcaaagcaaccttct
                                                       ******************

F7HHA1_BCL2L11-03      gatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcgga
F7HHA1_BCL2L11-02      gatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcgga
F7HHA1_BCL2L11-01      gatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcgga
                       **************************************************

F7HHA1_BCL2L11-03      gaggcctccccagctcagacctggggcccctacctccctacagacagagc
F7HHA1_BCL2L11-02      gaggcctccccagctcagacctggggcccctacctccctacagacagagc
F7HHA1_BCL2L11-01      gaggcctccccagctcagacctggggcccctacctccctacagacagagc
                       **************************************************

F7HHA1_BCL2L11-03      caca----------------------------------------------
F7HHA1_BCL2L11-02      cacaaggtaatcccgaaggcaatcacggaggtgaaggggacagctgcccc
F7HHA1_BCL2L11-01      cacaaggtaatcccgaaggcaatcacggaggtgaaggggacagctgcccc
                       ****                                              

F7HHA1_BCL2L11-03      --------------------------------------------------
F7HHA1_BCL2L11-02      cacggcagccctcagggcccgctggccccaccggccagccctggcccttt
F7HHA1_BCL2L11-01      cacggcagccctcagggcccgctggccccaccggccagccctggcccttt
                                                                         

F7HHA1_BCL2L11-03      --------------------------------------------------
F7HHA1_BCL2L11-02      tgctaccagatccccgcttttcatctttatgagaagatcctccctgctgt
F7HHA1_BCL2L11-01      tgctaccagatccccgcttttcatctttatgagaagatcctccctgctgt
                                                                         

F7HHA1_BCL2L11-03      ----------------------------------agacaggagcccagca
F7HHA1_BCL2L11-02      ctcgatcctccagtgggtatttctcttttgacacagacaggagcccagca
F7HHA1_BCL2L11-01      ctcgatcctccagtgggtatttctcttttgacacagacaggagcccagca
                                                         ****************

F7HHA1_BCL2L11-03      cccatgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggc
F7HHA1_BCL2L11-02      cccatgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggc
F7HHA1_BCL2L11-01      cccatgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggc
                       **************************************************

F7HHA1_BCL2L11-03      cttcaaccactatctcagtgcaatggcttccaggaggcaggctgaacctg
F7HHA1_BCL2L11-02      cttcaaccactatctcagtgcaatggcttccaggaggcaggctgaacctg
F7HHA1_BCL2L11-01      cttcaaccactatctcagtgcaatggcttccaggaggcaggctgaacctg
                       **************************************************

F7HHA1_BCL2L11-03      cagatatgcgcccggagatacggatcgcccaagagttgcggcgaatcgga
F7HHA1_BCL2L11-02      cagatatgcgcccggagatacggatcgcccaagagttgcggcgaatcgga
F7HHA1_BCL2L11-01      cagatatgcgcccggagatacggatcgcccaagagttgcggcgaatcgga
                       **************************************************

F7HHA1_BCL2L11-03      gacgagtttaacgcttactatgcaaggagggtatttttgaataattacca
F7HHA1_BCL2L11-02      gacgagtttaacgcttactatgcaaggagggtatttttgaataattacca
F7HHA1_BCL2L11-01      gacgagtttaacgcttactatgcaaggagggtatttttgaataattacca
                       **************************************************

F7HHA1_BCL2L11-03      agcagccgaagaccacccacaaatggttatcttacgactgttgcgttaca
F7HHA1_BCL2L11-02      agcagccgaagaccacccacaaatggttatcttacgactgttgcgttaca
F7HHA1_BCL2L11-01      agcagccgaagaccacccacaaatggttatcttacgactgttgcgttaca
                       **************************************************

F7HHA1_BCL2L11-03      ttgtccgcctggtgtggagaatgcattga
F7HHA1_BCL2L11-02      ttgtccgcctggtgtggagaatgcattga
F7HHA1_BCL2L11-01      ttgtccgcctggtgtggagaatgcattga
                       *****************************

© 1998-2020Legal notice