Dataset for CDS BCL2L11 of organism Macaca mulatta

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

F7HHA1_BCL2L11-03      atgttcccggcggctgcggccggggcagcgcgggccagaggcgcggcgtg
F7HHA1_BCL2L11-01      --------------------------------------------------
F7HHA1_BCL2L11-02      atgttcccggcggctgcggccggggcagcgcgggccagaggcgcggcgtg

F7HHA1_BCL2L11-03      cggagccctcggctgcccggcggagtgcggcggcgggctggcgggtaggc
F7HHA1_BCL2L11-01      --------------------------------------------------
F7HHA1_BCL2L11-02      cggagccctcggctgcccggcggagtgcggcggcgggctggcgggtaggc

F7HHA1_BCL2L11-03      gcgggctgtgcgctgcgccgggtactctgaacccaagtccagagctttgt
F7HHA1_BCL2L11-01      --------------------------------------------------
F7HHA1_BCL2L11-02      gcgggctgtgcgctgcgccgggtactctgaacccaagtccagagctttgt

F7HHA1_BCL2L11-03      ttcctgcgctgccttcgtggtgacggtcagggggcgccgggtcggcgaag
F7HHA1_BCL2L11-01      --------------------------------------------------
F7HHA1_BCL2L11-02      ttcctgcgctgccttcgtggtgacggtcagggggcgccgggtcggcgaag

F7HHA1_BCL2L11-03      agcgcgggccagacgccccggggcccgggcgcgggcccggacgctacgct
F7HHA1_BCL2L11-01      --------------------------------------------------
F7HHA1_BCL2L11-02      agcgcgggccagacgccccggggcccgggcgcgggcccggacgctacgct

F7HHA1_BCL2L11-03      ctgaagggaaggcgcggacaaaaaaagaccaaatggcaaagcaaccttct
F7HHA1_BCL2L11-01      --------------------------------atggcaaagcaaccttct
F7HHA1_BCL2L11-02      ctgaagggaaggcgcggacaaaaaaagaccaaatggcaaagcaaccttct

F7HHA1_BCL2L11-03      gatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcgga
F7HHA1_BCL2L11-01      gatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcgga
F7HHA1_BCL2L11-02      gatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcgga

F7HHA1_BCL2L11-03      gaggcctccccagctcagacctggggcccctacctccctacagacagagc
F7HHA1_BCL2L11-01      gaggcctccccagctcagacctggggcccctacctccctacagacagagc
F7HHA1_BCL2L11-02      gaggcctccccagctcagacctggggcccctacctccctacagacagagc

F7HHA1_BCL2L11-03      caca----------------------------------------------
F7HHA1_BCL2L11-01      cacaaggtaatcccgaaggcaatcacggaggtgaaggggacagctgcccc
F7HHA1_BCL2L11-02      cacaaggtaatcccgaaggcaatcacggaggtgaaggggacagctgcccc

F7HHA1_BCL2L11-03      --------------------------------------------------
F7HHA1_BCL2L11-01      cacggcagccctcagggcccgctggccccaccggccagccctggcccttt
F7HHA1_BCL2L11-02      cacggcagccctcagggcccgctggccccaccggccagccctggcccttt

F7HHA1_BCL2L11-03      --------------------------------------------------
F7HHA1_BCL2L11-01      tgctaccagatccccgcttttcatctttatgagaagatcctccctgctgt
F7HHA1_BCL2L11-02      tgctaccagatccccgcttttcatctttatgagaagatcctccctgctgt

F7HHA1_BCL2L11-03      ----------------------------------agacaggagcccagca
F7HHA1_BCL2L11-01      ctcgatcctccagtgggtatttctcttttgacacagacaggagcccagca
F7HHA1_BCL2L11-02      ctcgatcctccagtgggtatttctcttttgacacagacaggagcccagca

F7HHA1_BCL2L11-03      cccatgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggc
F7HHA1_BCL2L11-01      cccatgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggc
F7HHA1_BCL2L11-02      cccatgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggc

F7HHA1_BCL2L11-03      cttcaaccactatctcagtgcaatggcttccaggaggcaggctgaacctg
F7HHA1_BCL2L11-01      cttcaaccactatctcagtgcaatggcttccaggaggcaggctgaacctg
F7HHA1_BCL2L11-02      cttcaaccactatctcagtgcaatggcttccaggaggcaggctgaacctg

F7HHA1_BCL2L11-03      cagatatgcgcccggagatacggatcgcccaagagttgcggcgaatcgga
F7HHA1_BCL2L11-01      cagatatgcgcccggagatacggatcgcccaagagttgcggcgaatcgga
F7HHA1_BCL2L11-02      cagatatgcgcccggagatacggatcgcccaagagttgcggcgaatcgga

F7HHA1_BCL2L11-03      gacgagtttaacgcttactatgcaaggagggtatttttgaataattacca
F7HHA1_BCL2L11-01      gacgagtttaacgcttactatgcaaggagggtatttttgaataattacca
F7HHA1_BCL2L11-02      gacgagtttaacgcttactatgcaaggagggtatttttgaataattacca

F7HHA1_BCL2L11-03      agcagccgaagaccacccacaaatggttatcttacgactgttgcgttaca
F7HHA1_BCL2L11-01      agcagccgaagaccacccacaaatggttatcttacgactgttgcgttaca
F7HHA1_BCL2L11-02      agcagccgaagaccacccacaaatggttatcttacgactgttgcgttaca

F7HHA1_BCL2L11-03      ttgtccgcctggtgtggagaatgcattga
F7HHA1_BCL2L11-01      ttgtccgcctggtgtggagaatgcattga
F7HHA1_BCL2L11-02      ttgtccgcctggtgtggagaatgcattga

© 1998-2020Legal notice