Dataset for CDS BCL2L11 of organism Macaca mulatta

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|F7HHA1_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Macaca mulatta GN=BCL2L11 (length=597 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaac
gcttactatgcaaggagggtatttttgaataattaccaagcagccgaagaccacccacaaatggttatcttacgactgtt
gcgttacattgtccgcctggtgtggagaatgcattga
>gnl|bcl2dbcds|F7HHA1_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Macaca mulatta GN=BCL2L11 (length=879 residues).
atgttcccggcggctgcggccggggcagcgcgggccagaggcgcggcgtgcggagccctcggctgcccggcggagtgcgg
cggcgggctggcgggtaggcgcgggctgtgcgctgcgccgggtactctgaacccaagtccagagctttgtttcctgcgct
gccttcgtggtgacggtcagggggcgccgggtcggcgaagagcgcgggccagacgccccggggcccgggcgcgggcccgg
acgctacgctctgaagggaaggcgcggacaaaaaaagaccaaatggcaaagcaaccttctgatgtaagttctgagtgtga
ccgagaaggtagacaattgcagcctgcggagaggcctccccagctcagacctggggcccctacctccctacagacagagc
cacaaggtaatcccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctcagggcccgctggcccca
ccggccagccctggcccttttgctaccagatccccgcttttcatctttatgagaagatcctccctgctgtctcgatcctc
cagtgggtatttctcttttgacacagacaggagcccagcacccatgagttgtgacaaatcaacacaaaccccaagtcctc
cttgccaggccttcaaccactatctcagtgcaatggcttccaggaggcaggctgaacctgcagatatgcgcccggagata
cggatcgcccaagagttgcggcgaatcggagacgagtttaacgcttactatgcaaggagggtatttttgaataattacca
agcagccgaagaccacccacaaatggttatcttacgactgttgcgttacattgtccgcctggtgtggagaatgcattga
>gnl|bcl2dbcds|F7HHA1_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Macaca mulatta GN=BCL2L11 (length=699 residues).
atgttcccggcggctgcggccggggcagcgcgggccagaggcgcggcgtgcggagccctcggctgcccggcggagtgcgg
cggcgggctggcgggtaggcgcgggctgtgcgctgcgccgggtactctgaacccaagtccagagctttgtttcctgcgct
gccttcgtggtgacggtcagggggcgccgggtcggcgaagagcgcgggccagacgccccggggcccgggcgcgggcccgg
acgctacgctctgaagggaaggcgcggacaaaaaaagaccaaatggcaaagcaaccttctgatgtaagttctgagtgtga
ccgagaaggtagacaattgcagcctgcggagaggcctccccagctcagacctggggcccctacctccctacagacagagc
cacaagacaggagcccagcacccatgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccac
tatctcagtgcaatggcttccaggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcg
gcgaatcggagacgagtttaacgcttactatgcaaggagggtatttttgaataattaccaagcagccgaagaccacccac
aaatggttatcttacgactgttgcgttacattgtccgcctggtgtggagaatgcattga
© 1998-2020Legal notice