Dataset for CDS classical BH3-containing proteins of organism Hucho hucho

[Download (right click)] [Edit] [Sequences] [Repertoires]

10 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A4W5NF23_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A4W5N3A7_BMF-01       --------------------------------------------------
A0A4W5N721_BMF-01       --------------------------------------------------
A0A4W5JLL9_BAD-01       --------------------------------------------------
A0A4W5JLL9_BAD-02       atgttgtctccctctcctcctctccctttccctacctatccactctctct
A0A4W5MZR2_BAD-01       --------------------------------------------------
A0A4W5R1T6_BAD-01       -----atggctataatcaacactatcattcactgtggatgtcctttttct

A0A4W5NF23_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A4W5N3A7_BMF-01       --------------------------------------------------
A0A4W5N721_BMF-01       --------------------------------------------------
A0A4W5JLL9_BAD-01       --------------------------------------------------
A0A4W5JLL9_BAD-02       ctctgcctctcctcctgtctctttccctctctccacctctctctttccct
A0A4W5MZR2_BAD-01       --------------------------------------------------
A0A4W5R1T6_BAD-01       cttcagatatttaca-----------------------------------

A0A4W5NF23_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A4W5N3A7_BMF-01       --------------------------------------------------
A0A4W5N721_BMF-01       --------------------------------------------------
A0A4W5JLL9_BAD-01       --------------------------------------------------
A0A4W5JLL9_BAD-02       ccctctctacctctccactctctctctgccctctctccttcatctctctc
A0A4W5MZR2_BAD-01       --------------------------------------------------
A0A4W5R1T6_BAD-01       --------------------------------------------------

A0A4W5NF23_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A4W5N3A7_BMF-01       --------------------------------------------------
A0A4W5N721_BMF-01       --------------------------------------------------
A0A4W5JLL9_BAD-01       --------------------------------------------------
A0A4W5JLL9_BAD-02       taccctctctctccacacctcttccccctctcactccacccctcttcacc
A0A4W5MZR2_BAD-01       --------------------------------------------------
A0A4W5R1T6_BAD-01       --------------------------------------------------

A0A4W5NF23_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A4W5R3N6_BCL2L11      --------------------------------------------------
A0A4W5N3A7_BMF-01       --------------------------------------------------
A0A4W5N721_BMF-01       --------------------------------------------------
A0A4W5JLL9_BAD-01       --------------------------------------------------
A0A4W5JLL9_BAD-02       tccatctcactcctttcttgtttcccctctctcactcactcccctgcctc
A0A4W5MZR2_BAD-01       --------------------------------------------------
A0A4W5R1T6_BAD-01       --------------------------------------------------

A0A4W5NF23_BCL2L11      -----------------------atga-----------------------
A0A4W5R3N6_BCL2L11      -----------------------atgacattgcaccgacaaaataataaa
A0A4W5R3N6_BCL2L11      -----------------------atgac----------------------
A0A4W5R3N6_BCL2L11      -----------------------atgacattgcaccgacaaaataataaa
A0A4W5N3A7_BMF-01       -----------------------atgg-----------------------
A0A4W5N721_BMF-01       -----------------------atgg-----------------------
A0A4W5JLL9_BAD-01       -----------------------atgg-----------------------
A0A4W5JLL9_BAD-02       cctcttcctccgtagatgtcagcatgg-----------------------
A0A4W5MZR2_BAD-01       -----------------------atgg-----------------------
A0A4W5R1T6_BAD-01       -----------------------atga-----------------------

A0A4W5NF23_BCL2L11      -----------------------------------accacaatat-----
A0A4W5R3N6_BCL2L11      aatagcctaactctgatacttgatctatcttacagacaacaaaat-----
A0A4W5R3N6_BCL2L11      --------------------cgattcgtc---cagacaacaaaat-----
A0A4W5R3N6_BCL2L11      aatagcctaactctgatacttgatctatcttacagacaacaaaat-----
A0A4W5N3A7_BMF-01       --------------------------atgatgaggaggatgatgtgtt--
A0A4W5N721_BMF-01       --------------------------acgatgaggaggatgatgtgtt--
A0A4W5JLL9_BAD-01       --------------------------ctcagatgt-ttactatatcag--
A0A4W5JLL9_BAD-02       --------------------------ctcagatgt-ttactatatcag--
A0A4W5MZR2_BAD-01       --------------------------accacacacatgattgtgtggatg
A0A4W5R1T6_BAD-01       --------------------------accacacacatgattgtgtggatg
                                                              *     *     

A0A4W5NF23_BCL2L11      ----------------------------cggtccaaatgtctc-------
A0A4W5R3N6_BCL2L11      ----------------------------caatcc-aatggctc-------
A0A4W5R3N6_BCL2L11      ----------------------------caatcc-aatggctc-------
A0A4W5R3N6_BCL2L11      ----------------------------caatcc-aatggctc-------
A0A4W5N3A7_BMF-01       ----------------------------tgtgccagactcctcccactgc
A0A4W5N721_BMF-01       ----------------------------tgagccaga---ctcccactgc
A0A4W5JLL9_BAD-01       ------------------------acagcgagtcagagccctc-------
A0A4W5JLL9_BAD-02       ------------------------acagcgagtcagagccctc-------
A0A4W5MZR2_BAD-01       ------------------------aatgtgagtctgatcactc-------
A0A4W5R1T6_BAD-01       acaacccagaaaccatgaatgaaaaagatgagtctgaccactc-------
                                                         *  *   ***       

A0A4W5NF23_BCL2L11      --gaccaccctaattgagagaaggaaaagcggagagtcgcatcccggtgg
A0A4W5R3N6_BCL2L11      --gaccatcctaattgagagagggaaatacggagaattgaatcccggtgg
A0A4W5R3N6_BCL2L11      --gaccatcctaattgagagagggaaatacggagaattgaatcccggtgg
A0A4W5R3N6_BCL2L11      --gaccatcctaattgagagagggaaatacggagaattgaatcccggtgg
A0A4W5N3A7_BMF-01       tggcgcacagccttcagggaaataaagtacgaggac---ag----aggca
A0A4W5N721_BMF-01       tggcgcacagccttcagggagataaagtacgaggac---ag----gggaa
A0A4W5JLL9_BAD-01       -------------------agaggaggtaggagaaaccgaa----aagga
A0A4W5JLL9_BAD-02       -------------------agaggaggtaggagaaaccgaa----aagga
A0A4W5MZR2_BAD-01       -------------------------------aggaaccaca----cacaa
A0A4W5R1T6_BAD-01       -------------------------------aggaaccaca----cacta

A0A4W5NF23_BCL2L11      cggagcagcctcccgtgccgaaccgtctgacaaccc-----------cca
A0A4W5R3N6_BCL2L11      cggagcagcctccggtgccgaaccgactgacatccc-----------cca
A0A4W5R3N6_BCL2L11      cggagcagcctccggtgccgaaccgactgacatccc-----------cca
A0A4W5R3N6_BCL2L11      cggagcagcctccggtgccgaaccgactgacatccc-----------cca
A0A4W5N3A7_BMF-01       ccca--------------------gacacccagccc---------tgccc
A0A4W5N721_BMF-01       caca--------------------gacacccagccc---------tgtcc
A0A4W5JLL9_BAD-01       ccaattggctgccggaaaggggatgactggcggcccaataggccacgccc
A0A4W5JLL9_BAD-02       ccaattggctgccggaaaggggatgactggcggcccaataggccacgccc
A0A4W5MZR2_BAD-01       ctca--------------------gaatttcagctcca-------tgtct
A0A4W5R1T6_BAD-01       ccca--------------------gaatttcagctccata----ctgtct
                        *  *                    *     *  * *            * 

A0A4W5NF23_BCL2L11      gtcctgcgaaggggaccag-cagtcacggggaggaataa-tgattccgaa
A0A4W5R3N6_BCL2L11      gttcagcgaaggggaccag-cagtcacgtggaggaataa-tgatgccgaa
A0A4W5R3N6_BCL2L11      gttcagcgaaggggaccag-cagtcacgtggaggaataa-tgatgccgaa
A0A4W5R3N6_BCL2L11      gttcagcgaaggggaccag-cagtcacgtggaggaataa-tgatgccgaa
A0A4W5N3A7_BMF-01       tggcactgcgcaacaacatgctgccctgtgg---------ggagcccaga
A0A4W5N721_BMF-01       tgccactgcccaataatatgctgccctgcggggtggcccaggagcccaga
A0A4W5JLL9_BAD-01       tcactgtgcctgagatgagactggcaggagagggt-----cggttgagga
A0A4W5JLL9_BAD-02       tcactgtgcctgagatgagactggcaggagagggt-----cggttgagga
A0A4W5MZR2_BAD-01       caactacaatgagcaccagaccaagaccaggtgag-----cgagtccggc
A0A4W5R1T6_BAD-01       ccactacgacgagcaccagaccacgaccaggtggg-----cgagtccggc
                           *          *  *  *        *           *        

A0A4W5NF23_BCL2L11      tagtctgcttggtttccagtcgaggtcgccggtgttcagaacactgtaca
A0A4W5R3N6_BCL2L11      tagtctgcttggtttccagtcgaggtcgccggtgttcagaacactgtcca
A0A4W5R3N6_BCL2L11      tagtctgcttggtttccagtcgaggtcgccggtgttcagaacactgtcca
A0A4W5R3N6_BCL2L11      tagtctgcttggtttccagtcgaggtcgccggtgttcagaacactgtcca
A0A4W5N3A7_BMF-01       cca-ctcttctacggcaatgcaggctttcgattgcac-------------
A0A4W5N721_BMF-01       cca-ctcttctacggcaacgcaggctttcgattgcac-------------
A0A4W5JLL9_BAD-01       t--------------gaactcagagtcccagg------------------
A0A4W5JLL9_BAD-02       t--------------gaactcagagtcccagg------------------
A0A4W5MZR2_BAD-01       t--------------ctactcagagtcccaggtgtgc-------------
A0A4W5R1T6_BAD-01       t--------------ctactccgagtcccaggtgttc-------------
                                         *  *    *  *                     

A0A4W5NF23_BCL2L11      ggtcctccagtggatatttttcgttcgacagcgattctattccaagctcc
A0A4W5R3N6_BCL2L11      ggtcatccagtggatatttttcgttcgacagcgattctattccaagctcc
A0A4W5R3N6_BCL2L11      ggtcatccagtggatatttttcgttcgacagcgattctattccaagctcc
A0A4W5R3N6_BCL2L11      ggtcatccagtggatatttttcgttcgacagcgattctattccaagctcc
A0A4W5N3A7_BMF-01       ---------------------------------------tttccagc--g
A0A4W5N721_BMF-01       ---------------------------------------ttcccagc--g
A0A4W5JLL9_BAD-01       ----------------------------------------cccag-----
A0A4W5JLL9_BAD-02       ----------------------------------------cccag-----
A0A4W5MZR2_BAD-01       ---------------------------------------tcccaggttgg
A0A4W5R1T6_BAD-01       ---------------------------------------tcccacgttgg

A0A4W5NF23_BCL2L11      ccgctattgaaagataacaagtcgacacagactccgagcccatctagcca
A0A4W5R3N6_BCL2L11      ccgctattgaaagataacaagtcgacacagactccgagcccatcaagcca
A0A4W5R3N6_BCL2L11      ccgctattgaaagataacaagtcgacacagactccgagcccatcaagcca
A0A4W5R3N6_BCL2L11      ccgctattgaaagataacaagtcgacacagactccgagcccatcaagcca
A0A4W5N3A7_BMF-01       cggtttgagcaggttgg-----------agaccaggggcctcacgagcag
A0A4W5N721_BMF-01       cagtttgagcgtgttgg-----------agaccaggggcc----------
A0A4W5JLL9_BAD-01       ----------------g-----------agctccagggt-----------
A0A4W5JLL9_BAD-02       ----------------g-----------agctccagggt-----------
A0A4W5MZR2_BAD-01       caaaagggaaaacacag-----------agtttcaggatgtgatgactcc
A0A4W5R1T6_BAD-01       cagaagggacgacacag-----------agtttcaggatgcaatgactcc
                                                    **     *              

A0A4W5NF23_BCL2L11      agtcattacccacgcactgcagcgcctgtctcgggcactgga--------
A0A4W5R3N6_BCL2L11      aatcatgactcacgcactgcagcgcatgtctcaagcacagga--------
A0A4W5R3N6_BCL2L11      aatcatgactcacgcactgcagcgcatgtctcaagcacagga--------
A0A4W5R3N6_BCL2L11      aatcatgactcacgcactgcagcgcatgtctcaagcacagga--------
A0A4W5N3A7_BMF-01       catcaagg-----------------------ggagcgagggag-------
A0A4W5N721_BMF-01       --tctggg-----------------------ggagcgaggggg-------
A0A4W5JLL9_BAD-01       -----agg-----------------------gggccaggggtggaaggca
A0A4W5JLL9_BAD-02       -----agg-----------------------gggccaggggtggaaggca
A0A4W5MZR2_BAD-01       tactgagg-----------------------agggcggaggt--------
A0A4W5R1T6_BAD-01       tactgagg-----------------------agggcgggggc--------
                                                           *   **         

A0A4W5NF23_BCL2L11      --------gacccggcgagattatgacgtgtggcccaaccccctccggcc
A0A4W5R3N6_BCL2L11      --------gaccaatcgagattatgacgcgtggcccaaccccctccaccc
A0A4W5R3N6_BCL2L11      --------gaccaatcgagattatgacgcgtggcccaaccccctccaccc
A0A4W5R3N6_BCL2L11      --------gaccaatcgagattatgacgcgtggcccaaccccctccaccc
A0A4W5N3A7_BMF-01       --------aatggaa--------tggcttcaacagcagcctcagcagcca
A0A4W5N721_BMF-01       --------gatggag--------cggctcgatcagcagccccagctgcca
A0A4W5JLL9_BAD-01       tgcccacagacggagcatctttccgggttcgctcccagtcggccccccct
A0A4W5JLL9_BAD-02       tgcccacagacggagcatctttccgggttcgctcccagtcggccccccct
A0A4W5MZR2_BAD-01       --------gatggggcttcattccgaggccgatcacagtctgctcctcct
A0A4W5R1T6_BAD-01       --------gatggggctcctttccgaagccgatcacagtctgctcctcct
                                 *              *          **  *    *   * 

A0A4W5NF23_BCL2L11      ctatagagcacgcccaccaccgactgcgggggacatgcggccagagatac
A0A4W5R3N6_BCL2L11      ctatagaccacggccacaaccaactgcaggggacatgtggccagagacac
A0A4W5R3N6_BCL2L11      ctatagaccacggccacaaccaactgcaggggacatgtggccagagacac
A0A4W5R3N6_BCL2L11      ctatagaccacggccacaaccaactgcaggggacatgtggccagagacac
A0A4W5N3A7_BMF-01       gcac-----atagcat--------------------------ggaggtct
A0A4W5N721_BMF-01       gcac-----gcagcat--------------------------agaggtct
A0A4W5JLL9_BAD-01       gccctctgggcggcca--------------------------agaaata-
A0A4W5JLL9_BAD-02       gccctctgggcggcca--------------------------agaaata-
A0A4W5MZR2_BAD-01       gcactgtgggctgcaa--------------------------agaaata-
A0A4W5R1T6_BAD-01       gcactgtgggctgcaa--------------------------agaaata-
                                     *                             **     

A0A4W5NF23_BCL2L11      tcatcggtcaggagcttcggcgcattggagatgagttt------aacaac
A0A4W5R3N6_BCL2L11      tgatcggtcaggagcttcagcgcattggagatgagttt------aaccat
A0A4W5R3N6_BCL2L11      tgatcggtcaggagcttcagcgcattggagatgagttt------aaccat
A0A4W5R3N6_BCL2L11      tgatcggtcaggagcttcagcgcattggagatgagttt------aaccat
A0A4W5N3A7_BMF-01       gcattggacagaaactccaactcatcggagaccagttccaccaagaacac
A0A4W5N721_BMF-01       gcattggacagaaactccaactcatcggagaccagttccaccaagaacac
A0A4W5JLL9_BAD-01       ----cgggcggcagctccgacgcatgagtgacgagttt-------gatac
A0A4W5JLL9_BAD-02       ----cgggcggcagctccgacgcatgagtgacgagttt-------gatac
A0A4W5MZR2_BAD-01       ----tggctgccagctgaggaggatgagtgatgaattt-------gacac
A0A4W5R1T6_BAD-01       ----tggccgccagctgaggaggatgagtgatgaattt-------gacac
                             **     * **       **  * **  * **           * 

A0A4W5NF23_BCL2L11      ctcttcatacatcggcgccttgcaggcagaaacggtcaggttgcccaggg
A0A4W5R3N6_BCL2L11      ctcttcatacatggg------gtgagtaggtacac--------------c
A0A4W5R3N6_BCL2L11      ctcttcatacatgggcaccttcctggcagaaacgctcaagttgcccaggc
A0A4W5R3N6_BCL2L11      ctcttcatacatgggcaccttcctggcagaaacgctcaagttgcccaggc
A0A4W5N3A7_BMF-01       cttcaactgtatcac-------cgaaaccaaaggaacatgaggcccttgt
A0A4W5N721_BMF-01       cttcaagtgtatcac-------cgaaaccaaaggaacatgaggcccttgt
A0A4W5JLL9_BAD-01       gtggctggataaagg-------ggagatgaggcgggtgaagagtgcggga
A0A4W5JLL9_BAD-02       gtggctggataaagg-------ggagatgaggcgggtgaagagtgcggga
A0A4W5MZR2_BAD-01       ctggcttgacaaagg-------ggagcctaagagagggattagcccagga
A0A4W5R1T6_BAD-01       ctggctcgacaaagg-------ggagcccaagagagggattagcccagga
                         *        *                                       

A0A4W5NF23_BCL2L11      aaacctgca---------gcagatgcaccaagagcccgccttcctactgt
A0A4W5R3N6_BCL2L11      acaccagcactgagtcttgtatatacacataaag-------------ggt
A0A4W5R3N6_BCL2L11      aaacctgca---------gcagatgcaccaagagcccgccttcctactgt
A0A4W5R3N6_BCL2L11      aaacctgca---------gcagatgcaccaagagcccgccttcctactgt
A0A4W5N3A7_BMF-01       ------------------ggtggcgtgtgg-----------cctcagctc
A0A4W5N721_BMF-01       ------------------ggaggcgtctgg-----------cctcggctc
A0A4W5JLL9_BAD-01       ------------------gcagccaaacagatgaccaagtccccc--agc
A0A4W5JLL9_BAD-02       ------------------gcagccaaacagatgaccaagtccccc--agc
A0A4W5MZR2_BAD-01       ------------------ggaggcaagcaga-----aagtctcccgagga
A0A4W5R1T6_BAD-01       ------------------gggatcaagcagg-----aggtctcccgagga

A0A4W5NF23_BCL2L11      ggatgggtcttctgattgg--acgactattacagataatcc---------
A0A4W5R3N6_BCL2L11      tggaggagccacagattagtaaagatgatgataatgcccct---------
A0A4W5R3N6_BCL2L11      ggatggggctcctgattgg--acgactattacagatcatcc---------
A0A4W5R3N6_BCL2L11      ggatggggctcctgattgg--acgactattacagatcatcc---------
A0A4W5N3A7_BMF-01       tgctcaccctgctgtttga----gc----aggaggccatcgctggagggg
A0A4W5N721_BMF-01       tgctcaccctgctgtttga----gc----aggaggccatcgctggagggg
A0A4W5JLL9_BAD-01       tggtgggcctacctgttca----gtcataaggagac--------------
A0A4W5JLL9_BAD-02       tggtgggcctacctgttca----gtcataaggagac--------------
A0A4W5MZR2_BAD-01       tggttctctttcctctgga----gtccaaaggaggc--------------
A0A4W5R1T6_BAD-01       tggttctctttcctctgga----gtccaaaggagtc--------------
                         *         *   *       *        *                 

A0A4W5NF23_BCL2L11      tgcgg--aga-------------------------------agatg----
A0A4W5R3N6_BCL2L11      tatatccaga-------------------------------agatgcatc
A0A4W5R3N6_BCL2L11      tgcag--aga-------------------------------agatg----
A0A4W5R3N6_BCL2L11      tgcag--aga-------------------------------agatg----
A0A4W5N3A7_BMF-01       ggagagcagg---------------------------gtggaggtg----
A0A4W5N721_BMF-01       ggagagcagg---------------------------gtggaggtg----
A0A4W5JLL9_BAD-01       ag-agacagaacatacccctaccatcccaccacgatcatctgagta----
A0A4W5JLL9_BAD-02       ag-agacagaacatacccctaccatcccaccacgatcatctgagta----
A0A4W5MZR2_BAD-01       ggaaggcagg-------------------------------gagtg----
A0A4W5R1T6_BAD-01       ggaaggcagg-------------------------------gagtg----
                               **                                   *     

A0A4W5NF23_BCL2L11      ----------------------a
A0A4W5R3N6_BCL2L11      attttgggcgcgttagcatttaa
A0A4W5R3N6_BCL2L11      ----------------------a
A0A4W5R3N6_BCL2L11      ----------------------a
A0A4W5N3A7_BMF-01       ----------------------a
A0A4W5N721_BMF-01       ----------------------a
A0A4W5JLL9_BAD-01       ----------------------g
A0A4W5JLL9_BAD-02       ----------------------g
A0A4W5MZR2_BAD-01       ----------------------a
A0A4W5R1T6_BAD-01       ----------------------a

© 1998-2021Legal notice