Dataset for CDS classical BH3-containing proteins of organism Hucho hucho

[Download (right click)] [Alignment] [Repertoires]

10 sequence(s)

>gnl|bcl2dbcds|A0A4W5JLL9_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Hucho hucho GN=BAD (length=486 residues).
atggctcagatgtttactatatcagacagcgagtcagagccctcagaggaggtaggagaaaccgaaaaggaccaattggc
tgccggaaaggggatgactggcggcccaataggccacgccctcactgtgcctgagatgagactggcaggagagggtcggt
tgaggatgaactcagagtcccaggcccaggagctccagggtagggggccaggggtggaaggcatgcccacagacggagca
tctttccgggttcgctcccagtcggccccccctgccctctgggcggccaagaaatacgggcggcagctccgacgcatgag
tgacgagtttgatacgtggctggataaaggggagatgaggcgggtgaagagtgcgggagcagccaaacagatgaccaagt
cccccagctggtgggcctacctgttcagtcataaggagacagagacagaacatacccctaccatcccaccacgatcatct
gagtag
>gnl|bcl2dbcds|A0A4W5JLL9_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Hucho hucho GN=BAD (length=759 residues).
atgttgtctccctctcctcctctccctttccctacctatccactctctctctctgcctctcctcctgtctctttccctct
ctccacctctctctttccctccctctctacctctccactctctctctgccctctctccttcatctctctctaccctctct
ctccacacctcttccccctctcactccacccctcttcacctccatctcactcctttcttgtttcccctctctcactcact
cccctgcctccctcttcctccgtagatgtcagcatggctcagatgtttactatatcagacagcgagtcagagccctcaga
ggaggtaggagaaaccgaaaaggaccaattggctgccggaaaggggatgactggcggcccaataggccacgccctcactg
tgcctgagatgagactggcaggagagggtcggttgaggatgaactcagagtcccaggcccaggagctccagggtaggggg
ccaggggtggaaggcatgcccacagacggagcatctttccgggttcgctcccagtcggccccccctgccctctgggcggc
caagaaatacgggcggcagctccgacgcatgagtgacgagtttgatacgtggctggataaaggggagatgaggcgggtga
agagtgcgggagcagccaaacagatgaccaagtcccccagctggtgggcctacctgttcagtcataaggagacagagaca
gaacatacccctaccatcccaccacgatcatctgagtag
>gnl|bcl2dbcds|A0A4W5MZR2_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Hucho hucho GN=BAD (length=444 residues).
atggaccacacacatgattgtgtggatgaatgtgagtctgatcactcaggaaccacacacaactcagaatttcagctcca
tgtctcaactacaatgagcaccagaccaagaccaggtgagcgagtccggctctactcagagtcccaggtgtgctcccagg
ttggcaaaagggaaaacacagagtttcaggatgtgatgactcctactgaggagggcggaggtgatggggcttcattccga
ggccgatcacagtctgctcctcctgcactgtgggctgcaaagaaatatggctgccagctgaggaggatgagtgatgaatt
tgacacctggcttgacaaaggggagcctaagagagggattagcccaggaggaggcaagcagaaagtctcccgaggatggt
tctctttcctctggagtccaaaggaggcggaaggcagggagtga
>gnl|bcl2dbcds|A0A4W5N3A7_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Hucho hucho GN=BMF (length=486 residues).
atggatgatgaggaggatgatgtgtttgtgccagactcctcccactgctggcgcacagccttcagggaaataaagtacga
ggacagaggcacccagacacccagccctgccctggcactgcgcaacaacatgctgccctgtggggagcccagaccactct
tctacggcaatgcaggctttcgattgcactttccagcgcggtttgagcaggttggagaccaggggcctcacgagcagcat
caaggggagcgagggagaatggaatggcttcaacagcagcctcagcagccagcacatagcatggaggtctgcattggaca
gaaactccaactcatcggagaccagttccaccaagaacaccttcaactgtatcaccgaaaccaaaggaacatgaggccct
tgtggtggcgtgtggcctcagctctgctcaccctgctgtttgagcaggaggccatcgctggaggggggagagcagggtgg
aggtga
>gnl|bcl2dbcds|A0A4W5N721_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Hucho hucho GN=BMF (length=480 residues).
atggacgatgaggaggatgatgtgtttgagccagactcccactgctggcgcacagccttcagggagataaagtacgagga
caggggaacacagacacccagccctgtcctgccactgcccaataatatgctgccctgcggggtggcccaggagcccagac
cactcttctacggcaacgcaggctttcgattgcacttcccagcgcagtttgagcgtgttggagaccaggggcctctgggg
gagcgaggggggatggagcggctcgatcagcagccccagctgccagcacgcagcatagaggtctgcattggacagaaact
ccaactcatcggagaccagttccaccaagaacaccttcaagtgtatcaccgaaaccaaaggaacatgaggcccttgtgga
ggcgtctggcctcggctctgctcaccctgctgtttgagcaggaggccatcgctggaggggggagagcagggtggaggtga
>gnl|bcl2dbcds|A0A4W5NF23_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Hucho hucho GN=BCL2L11 (length=636 residues).
atgaaccacaatatcggtccaaatgtctcgaccaccctaattgagagaaggaaaagcggagagtcgcatcccggtggcgg
agcagcctcccgtgccgaaccgtctgacaacccccagtcctgcgaaggggaccagcagtcacggggaggaataatgattc
cgaatagtctgcttggtttccagtcgaggtcgccggtgttcagaacactgtacaggtcctccagtggatatttttcgttc
gacagcgattctattccaagctccccgctattgaaagataacaagtcgacacagactccgagcccatctagccaagtcat
tacccacgcactgcagcgcctgtctcgggcactggagacccggcgagattatgacgtgtggcccaaccccctccggccct
atagagcacgcccaccaccgactgcgggggacatgcggccagagatactcatcggtcaggagcttcggcgcattggagat
gagtttaacaacctcttcatacatcggcgccttgcaggcagaaacggtcaggttgcccagggaaacctgcagcagatgca
ccaagagcccgccttcctactgtggatgggtcttctgattggacgactattacagataatcctgcggagaagatga
>gnl|bcl2dbcds|A0A4W5R1T6_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Hucho hucho GN=BAD (length=531 residues).
atggctataatcaacactatcattcactgtggatgtcctttttctcttcagatatttacaatgaaccacacacatgattg
tgtggatgacaacccagaaaccatgaatgaaaaagatgagtctgaccactcaggaaccacacactacccagaatttcagc
tccatactgtctccactacgacgagcaccagaccacgaccaggtgggcgagtccggctctactccgagtcccaggtgttc
tcccacgttggcagaagggacgacacagagtttcaggatgcaatgactcctactgaggagggcgggggcgatggggctcc
tttccgaagccgatcacagtctgctcctcctgcactgtgggctgcaaagaaatatggccgccagctgaggaggatgagtg
atgaatttgacacctggctcgacaaaggggagcccaagagagggattagcccaggagggatcaagcaggaggtctcccga
ggatggttctctttcctctggagtccaaaggagtcggaaggcagggagtga
>gnl|bcl2dbcds|A0A4W5R3N6_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Hucho hucho GN=BCL2L11 (length=648 residues).
atgaccgattcgtccagacaacaaaatcaatccaatggctcgaccatcctaattgagagagggaaatacggagaattgaa
tcccggtggcggagcagcctccggtgccgaaccgactgacatcccccagttcagcgaaggggaccagcagtcacgtggag
gaataatgatgccgaatagtctgcttggtttccagtcgaggtcgccggtgttcagaacactgtccaggtcatccagtgga
tatttttcgttcgacagcgattctattccaagctccccgctattgaaagataacaagtcgacacagactccgagcccatc
aagccaaatcatgactcacgcactgcagcgcatgtctcaagcacaggagaccaatcgagattatgacgcgtggcccaacc
ccctccacccctatagaccacggccacaaccaactgcaggggacatgtggccagagacactgatcggtcaggagcttcag
cgcattggagatgagtttaaccatctcttcatacatgggcaccttcctggcagaaacgctcaagttgcccaggcaaacct
gcagcagatgcaccaagagcccgccttcctactgtggatggggctcctgattggacgactattacagatcatcctgcaga
gaagatga
>gnl|bcl2dbcds|A0A4W5R3N6_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Hucho hucho GN=BCL2L11 (length=693 residues).
atgacattgcaccgacaaaataataaaaatagcctaactctgatacttgatctatcttacagacaacaaaatcaatccaa
tggctcgaccatcctaattgagagagggaaatacggagaattgaatcccggtggcggagcagcctccggtgccgaaccga
ctgacatcccccagttcagcgaaggggaccagcagtcacgtggaggaataatgatgccgaatagtctgcttggtttccag
tcgaggtcgccggtgttcagaacactgtccaggtcatccagtggatatttttcgttcgacagcgattctattccaagctc
cccgctattgaaagataacaagtcgacacagactccgagcccatcaagccaaatcatgactcacgcactgcagcgcatgt
ctcaagcacaggagaccaatcgagattatgacgcgtggcccaaccccctccacccctatagaccacggccacaaccaact
gcaggggacatgtggccagagacactgatcggtcaggagcttcagcgcattggagatgagtttaaccatctcttcataca
tgggcaccttcctggcagaaacgctcaagttgcccaggcaaacctgcagcagatgcaccaagagcccgccttcctactgt
ggatggggctcctgattggacgactattacagatcatcctgcagagaagatga
>gnl|bcl2dbcds|A0A4W5R3N6_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Hucho hucho GN=BCL2L11 (length=699 residues).
atgacattgcaccgacaaaataataaaaatagcctaactctgatacttgatctatcttacagacaacaaaatcaatccaa
tggctcgaccatcctaattgagagagggaaatacggagaattgaatcccggtggcggagcagcctccggtgccgaaccga
ctgacatcccccagttcagcgaaggggaccagcagtcacgtggaggaataatgatgccgaatagtctgcttggtttccag
tcgaggtcgccggtgttcagaacactgtccaggtcatccagtggatatttttcgttcgacagcgattctattccaagctc
cccgctattgaaagataacaagtcgacacagactccgagcccatcaagccaaatcatgactcacgcactgcagcgcatgt
ctcaagcacaggagaccaatcgagattatgacgcgtggcccaaccccctccacccctatagaccacggccacaaccaact
gcaggggacatgtggccagagacactgatcggtcaggagcttcagcgcattggagatgagtttaaccatctcttcataca
tggggtgagtaggtacaccacaccagcactgagtcttgtatatacacataaagggttggaggagccacagattagtaaag
atgatgataatgccccttatatccagaagatgcatcattttgggcgcgttagcatttaa
© 1998-2020Legal notice