Dataset for CDS BMF of organism Hucho hucho

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A4W5N3A7_BMF-01      atggatgatgaggaggatgatgtgtttgtgccagactcctcccactgctg
A0A4W5N721_BMF-01      atggacgatgaggaggatgatgtgtttgagccaga---ctcccactgctg
                       ***** ********************** ******   ************

A0A4W5N3A7_BMF-01      gcgcacagccttcagggaaataaagtacgaggacagaggcacccagacac
A0A4W5N721_BMF-01      gcgcacagccttcagggagataaagtacgaggacaggggaacacagacac
                       ****************** ***************** ** ** *******

A0A4W5N3A7_BMF-01      ccagccctgccctggcactgcgcaacaacatgctgccctgtgg-------
A0A4W5N721_BMF-01      ccagccctgtcctgccactgcccaataatatgctgccctgcggggtggcc
                       ********* **** ****** *** ** *********** **       

A0A4W5N3A7_BMF-01      --ggagcccagaccactcttctacggcaatgcaggctttcgattgcactt
A0A4W5N721_BMF-01      caggagcccagaccactcttctacggcaacgcaggctttcgattgcactt
                         *************************** ********************

A0A4W5N3A7_BMF-01      tccagcgcggtttgagcaggttggagaccaggggcctcacgagcagcatc
A0A4W5N721_BMF-01      cccagcgcagtttgagcgtgttggagaccaggggcc------------tc
                        ******* ********  *****************            **

A0A4W5N3A7_BMF-01      aaggggagcgagggagaatggaatggcttcaacagcagcctcagcagcca
A0A4W5N721_BMF-01      tgggggagcgaggggggatggagcggctcgatcagcagccccagctgcca
                         ************ * *****  ****  * ******** **** ****

A0A4W5N3A7_BMF-01      gcacatagcatggaggtctgcattggacagaaactccaactcatcggaga
A0A4W5N721_BMF-01      gcacgcagcatagaggtctgcattggacagaaactccaactcatcggaga
                       ****  ***** **************************************

A0A4W5N3A7_BMF-01      ccagttccaccaagaacaccttcaactgtatcaccgaaaccaaaggaaca
A0A4W5N721_BMF-01      ccagttccaccaagaacaccttcaagtgtatcaccgaaaccaaaggaaca
                       ************************* ************************

A0A4W5N3A7_BMF-01      tgaggcccttgtggtggcgtgtggcctcagctctgctcaccctgctgttt
A0A4W5N721_BMF-01      tgaggcccttgtggaggcgtctggcctcggctctgctcaccctgctgttt
                       ************** ***** ******* *********************

A0A4W5N3A7_BMF-01      gagcaggaggccatcgctggaggggggagagcagggtggaggtga
A0A4W5N721_BMF-01      gagcaggaggccatcgctggaggggggagagcagggtggaggtga
                       *********************************************

© 1998-2020Legal notice