Dataset for CDS BMF of organism Hucho hucho

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A4W5N3A7_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Hucho hucho GN=BMF (length=486 residues).
atggatgatgaggaggatgatgtgtttgtgccagactcctcccactgctggcgcacagccttcagggaaataaagtacga
ggacagaggcacccagacacccagccctgccctggcactgcgcaacaacatgctgccctgtggggagcccagaccactct
tctacggcaatgcaggctttcgattgcactttccagcgcggtttgagcaggttggagaccaggggcctcacgagcagcat
caaggggagcgagggagaatggaatggcttcaacagcagcctcagcagccagcacatagcatggaggtctgcattggaca
gaaactccaactcatcggagaccagttccaccaagaacaccttcaactgtatcaccgaaaccaaaggaacatgaggccct
tgtggtggcgtgtggcctcagctctgctcaccctgctgtttgagcaggaggccatcgctggaggggggagagcagggtgg
aggtga
>gnl|bcl2dbcds|A0A4W5N721_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Hucho hucho GN=BMF (length=480 residues).
atggacgatgaggaggatgatgtgtttgagccagactcccactgctggcgcacagccttcagggagataaagtacgagga
caggggaacacagacacccagccctgtcctgccactgcccaataatatgctgccctgcggggtggcccaggagcccagac
cactcttctacggcaacgcaggctttcgattgcacttcccagcgcagtttgagcgtgttggagaccaggggcctctgggg
gagcgaggggggatggagcggctcgatcagcagccccagctgccagcacgcagcatagaggtctgcattggacagaaact
ccaactcatcggagaccagttccaccaagaacaccttcaagtgtatcaccgaaaccaaaggaacatgaggcccttgtgga
ggcgtctggcctcggctctgctcaccctgctgtttgagcaggaggccatcgctggaggggggagagcagggtggaggtga
© 1998-2020Legal notice