Dataset for CDS HRK of organism Homo sapiens

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


O00198_HRK-01      atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgcctgcagcgcg
O00198_HRK-03      ------------------------------------------------------------
                                                                               

O00198_HRK-01      ggtcgcctggggctgcgctcgtccgccgcgcagctcaccgccgcccggctcaaggcgcta
O00198_HRK-03      ------------------------------------------------------------
                                                                               

O00198_HRK-01      ggcgacgagctgcaccagcgcaccatgtggcggcgccgcgcgcggagccggagggcgccg
O00198_HRK-03      ------------------------------------------------------------
                                                                               

O00198_HRK-01      gcgcccggcgcgctccccacctactggccttggctgtgcgcggccgcgcaggtggcggcg
O00198_HRK-03      ---------------------------------------gcggccgcgcaggtggcggcg
                                                          *********************

O00198_HRK-01      ctggcggcctggctgctcggcaggcggaacttgtag
O00198_HRK-03      ctggcggcctggctgctcggcaggcggaacttgtag
                   ************************************

© 1998-2020Legal notice