Dataset for CDS HRK of organism Homo sapiens

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|O00198_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Homo sapiens GN=HRK (length=276 residues).
atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgcctgcagcgcgggtcgcctggggctgcgctc
gtccgccgcgcagctcaccgccgcccggctcaaggcgctaggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccggcgcccggcgcgctccccacctactggccttggctgtgcgcggccgcgcaggtggcggcg
ctggcggcctggctgctcggcaggcggaacttgtag
>gnl|bcl2dbcds|O00198_HRK-03 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Homo sapiens GN=HRK (length=57 residues).
gcggccgcgcaggtggcggcgctggcggcctggctgctcggcaggcggaacttgtag
© 1998-2020Legal notice