Dataset for CDS classical BH3-containing proteins of organism Gorilla gorilla gorilla

[Download (right click)] [Edit] [Sequences] [Repertoires]

11 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


G3QCT2_BIK-01           atgtctgaagtaagacccctctccagagacatcttgatggagaccctcct
G3QTJ6_HRK-01           atgt----------gcccgtgccc--------------------------
A0A2I2YVQ5_PMAIP1-      atgc----------------------------------------------
A0A2I2YVQ5_PMAIP1-      atgc----------------------------------------------
A0A2I2YQ13_BCL2L11      atggcaaagcaaccttctgatgtaagt-----------------------
A0A2I2YQ13_BCL2L11      atggcaaagcaaccttctgatgtaagt-----------------------
A0A2I2Z168_BMF-02       atgg----------agcc-atctcagtg----------------------
A0A2I2Z168_BMF-01       atgg----------agcc-atctcagtg----------------------
A0A2I2Z8C7_BAD-02       atgt----------tccagatcccagag----------------------
A0A2I2Z8C7_BAD-01       atgt----------tccagatcccagag----------------------
A0A2I2Z8C7_BAD-03       atgt----------tccagatcccagag----------------------
                        ***                                               

G3QCT2_BIK-01           gtatgagcagctcctggaacccccgaccatggaggttcttggcgtgactg
G3QTJ6_HRK-01           ------------cctgcaccgcggccgcggccccccggccgtgtgcgcct
A0A2I2YVQ5_PMAIP1-      -------------ctgggaagaaggcgcgcaagaacgctcaaccgagccc
A0A2I2YVQ5_PMAIP1-      -------------ctgggaagaaggcgcgcaagaacgctcaaccgagccc
A0A2I2YQ13_BCL2L11      ------------tctga---gtgtgaccgagaaggtagacaattgcagcc
A0A2I2YQ13_BCL2L11      ------------tctga---gtgtgaccgagaaggtagacaattgcagcc
A0A2I2Z168_BMF-02       ------------tgtg----gag-gagctggaggatgatgtgttccaacc
A0A2I2Z168_BMF-01       ------------tgtg----gag-gagctggaggatgatgtgttccaacc
A0A2I2Z8C7_BAD-02       ------------tttgagccgagtgagcaggaaga-------ctccagct
A0A2I2Z8C7_BAD-01       ------------tttgagccgagtgagcaggaaga-------ctccagct
A0A2I2Z8C7_BAD-03       ------------tttgagccgagtgagcaggaaga-------ctccagct
                                      **           *                      

G3QCT2_BIK-01           actctgaagaggacctggaccctatggaggacttcgattctttggagtgc
G3QTJ6_HRK-01           gcagcgcgggtcgcctggggctgc--------------------------
A0A2I2YVQ5_PMAIP1-      c-----------gcgcgggctcca--------------------------
A0A2I2YVQ5_PMAIP1-      c-----------gcgcgggctcca--------------------------
A0A2I2YQ13_BCL2L11      ---tgcggagaggcct---cccca--------------------------
A0A2I2YQ13_BCL2L11      ---tgcggagaggcct---cccca--------------------------
A0A2I2Z168_BMF-02       agaggatggggagccggtgaccca--------------------------
A0A2I2Z168_BMF-01       agaggatggggagccggtgaccca--------------------------
A0A2I2Z8C7_BAD-02       ctgcagagaggggcctgggcccca--------------------------
A0A2I2Z8C7_BAD-01       ctgcagagaggggcctgggcccca--------------------------
A0A2I2Z8C7_BAD-03       ctgcagagaggggcctgggcccca--------------------------
                                     *                                    

G3QCT2_BIK-01           atggagggcagtgacgcgttggccctgcggctggcctgcatcggggatga
G3QTJ6_HRK-01           ---------------------gctcgtccgccgcgcagctcaccg---cc
A0A2I2YVQ5_PMAIP1-      ---------------------gcag-------------------------
A0A2I2YVQ5_PMAIP1-      ---------------------gcaggaccggcgggtacggcgagggacca
A0A2I2YQ13_BCL2L11      ---------------------gctc-----------agacctggggcccc
A0A2I2YQ13_BCL2L11      ---------------------gctc-----------agacctggggcccc
A0A2I2Z168_BMF-02       ---------------------accc----gggagcttgctctctg---ct
A0A2I2Z168_BMF-01       ---------------------accc----gggagcttgctctctg---ct
A0A2I2Z8C7_BAD-02       ---------------------gccccgcaggggacgggccctcaggctcc
A0A2I2Z8C7_BAD-01       ---------------------gccccgcaggggacgggccctcaggctcc
A0A2I2Z8C7_BAD-03       ---------------------gccccgcaggggacgggccctcaggctcc
                                              *                           

G3QCT2_BIK-01           gatggacgtgagcctcagggccccgcgcctggcccagctctccgaggtgg
G3QTJ6_HRK-01           gcccggctcaaggcgctaggcgacgagc----------tgcaccagcgca
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      agccggctttggg-attgagatgcagctgcg-------tttcaccagggg
A0A2I2YQ13_BCL2L11      tacctccctacag-acagagccacaaggtaa-------tcctgaagg---
A0A2I2YQ13_BCL2L11      tacctccctacag-acagagccacaaggtaa-------tcctgaagg---
A0A2I2Z168_BMF-02       gacctgttt----------gcccagagcc---------tactggactgcc
A0A2I2Z168_BMF-01       gacctgttt----------gcccagagcc---------tactggactgcc
A0A2I2Z8C7_BAD-02       ggcaagcatcatc-gccaggccccaggcc---------tcctgtgggacg
A0A2I2Z8C7_BAD-01       ggcaagcatcatc-gccaggccccaggcc---------tcctgtgggacg
A0A2I2Z8C7_BAD-03       ggcaagcatcatc-gccaggccccaggcc---------tcctgtgggacg
                                                                          

G3QCT2_BIK-01           ccatgcacagcctgggtctggctttcatctacgaccagaccgaggacatc
G3QTJ6_HRK-01           ccatgtggcg---gcgccgcgcgcggagccggagggcgccggcgcccggc
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      caaaaagctc---ctttcctcctcgccacttgcccttccccggggccacg
A0A2I2YQ13_BCL2L11      -caatcacgg---aggtgaaggggacagctgcc--cccacggcagccctc
A0A2I2YQ13_BCL2L11      -caatcacgg---aggtgaaggggacagctgcc--cccacggcagccctc
A0A2I2Z168_BMF-02       ccctcagccg---acttc--------agctcttccctctcacccactgct
A0A2I2Z168_BMF-01       ccctcagccg---acttc--------agctcttccctctcacccactgct
A0A2I2Z8C7_BAD-02       ccagtcacca---gcagg--------agcagccaaccagcagcagccatc
A0A2I2Z8C7_BAD-01       ccagtcacca---gcagg--------agcagccaaccagcagcagccatc
A0A2I2Z8C7_BAD-03       ccagtcacca---gcagg--------agcagccaaccagcagcagccatc
                                                                          

G3QCT2_BIK-01           aggg-----------------atgttcttagaagtttcatggacggtttc
G3QTJ6_HRK-01           gcg-------------------------------------ctccccacct
A0A2I2YVQ5_PMAIP1-      ----------------agctggaagtcgagtgtgc-----tactcaactc
A0A2I2YVQ5_PMAIP1-      aggaacaagtgcaagtagctggaagtcgagtgtgc-----tactcaactc
A0A2I2YQ13_BCL2L11      aggg------------------------------cc----cgctggcccc
A0A2I2YQ13_BCL2L11      aggg------------------------------cc----cgctggcccc
A0A2I2Z168_BMF-02       gtgg------------------------------ccctggccttcgaccc
A0A2I2Z168_BMF-01       gtgg------------------------------ccctggccttcgaccc
A0A2I2Z8C7_BAD-02       atggaggcgctggggctgtggagatccggagtcgccacagctcctacccc
A0A2I2Z8C7_BAD-01       atggaggcgctggggctgtggagatccggagtcgccacagctcctacccc
A0A2I2Z8C7_BAD-03       atgg----------------------------------------------
                                                                          

G3QCT2_BIK-01           accacccttaaggagaacataatgagg-----------------------
G3QTJ6_HRK-01           actggccttggctg------------------------------------
A0A2I2YVQ5_PMAIP1-      aggagatttggagacaa---------------------------------
A0A2I2YVQ5_PMAIP1-      aggagatttggagacaa---------------------------------
A0A2I2YQ13_BCL2L11      accggccag---------------------------ccctggccctt---
A0A2I2YQ13_BCL2L11      accggccag---------------------------ccctggccctt---
A0A2I2Z168_BMF-02       accagccaggaagacaa--------------agctacccagaccctc---
A0A2I2Z168_BMF-01       accagccaggaagacaa--------------agctacccagaccctc---
A0A2I2Z8C7_BAD-02       gcggggacggaggacgacgaagggatgggggaggagcccagcccctttcg
A0A2I2Z8C7_BAD-01       gcggggacggaggacgacgaagggatgggggaggagcccagcccctttcg
A0A2I2Z8C7_BAD-03       --------------------------------------------------
                                                                          

G3QCT2_BIK-01           ----------ttctggagatccccgaaccccgggtcctgggtgtcccgcg
G3QTJ6_HRK-01           --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      ------------actgaacttcc---------------------------
A0A2I2YVQ5_PMAIP1-      ------------actgaacttcc---------------------------
A0A2I2YQ13_BCL2L11      -------ttgctaccagatcccc-----------gcttttcatctttatg
A0A2I2YQ13_BCL2L11      -------ttgctaccagatcccc-----------gcttttcatctttatg
A0A2I2Z168_BMF-02       ----------agcccagcctcccccagccaaggtgtcatgctgccttgtg
A0A2I2Z168_BMF-01       ----------agcccagcctcccccagccaaggtgtcatgctgccttgtg
A0A2I2Z8C7_BAD-02       gggccgctcgcgctcggcgccccccaacctctgggcagcacagcgctatg
A0A2I2Z8C7_BAD-01       gggccgctcgcgctcggcgccccccaacctctgggcagcacagcgctatg
A0A2I2Z8C7_BAD-03       --------------------------------------------------
                                                                          

G3QCT2_BIK-01           ----------------------------------------------aaca
G3QTJ6_HRK-01           --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      ----------------------------------------------ggca
A0A2I2YVQ5_PMAIP1-      ----------------------------------------------ggca
A0A2I2YQ13_BCL2L11      ----------------------------------------------agaa
A0A2I2YQ13_BCL2L11      ----------------------------------------------agaa
A0A2I2Z168_BMF-02       ---------------gggtgactgaggaaccccagcgactcttttatg--
A0A2I2Z168_BMF-01       ---------------gggtgactgaggaaccccagcgactcttttatggc
A0A2I2Z8C7_BAD-02       gccgcgagctccggaggatgagtgacgagtttgtg-gactcctttaagaa
A0A2I2Z8C7_BAD-01       gccgcgagctccggaggatgagtgacgagtttgtg-gactcctttaagaa
A0A2I2Z8C7_BAD-03       ----------------------------------------------agaa
                                                                          

G3QCT2_BIK-01           ggtgctgctg----------------------------------------
G3QTJ6_HRK-01           --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      gaaacttctg----------------------------------------
A0A2I2YVQ5_PMAIP1-      gaaacttctg----------------------------------------
A0A2I2YQ13_BCL2L11      gatcctccct----------------------------------------
A0A2I2YQ13_BCL2L11      gatcctccct----------------------------------------
A0A2I2Z168_BMF-02       --------------------------------------------------
A0A2I2Z168_BMF-01       aatgctggctatcggcttcctctccctgccagtttcccagcagtcttgcc
A0A2I2Z8C7_BAD-02       gggacttcct----------------------------------------
A0A2I2Z8C7_BAD-01       gggacttcct----------------------------------------
A0A2I2Z8C7_BAD-03       gggacttcct----------------------------------------
                                                                          

G3QCT2_BIK-01           --------------------------------------------------
G3QTJ6_HRK-01           --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------aatctga-----------------------------
A0A2I2YVQ5_PMAIP1-      --------------aatctga-----------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I2Z168_BMF-02       --------------------------------------------------
A0A2I2Z168_BMF-01       cattggggagcagccccccgaagggcagtggcaacatcgagcagaggtac
A0A2I2Z8C7_BAD-02       --------------cgcccgaagagcgcaggcacagcaacgcaga-----
A0A2I2Z8C7_BAD-01       --------------cgcccgaagagcgcaggcacagcaacgcaga-----
A0A2I2Z8C7_BAD-03       --------------cgcccgaagagcgcaggcacagcaacgcaga-----
                                                                          

G3QCT2_BIK-01           -----gcgctgctgctgctg------------------------------
G3QTJ6_HRK-01           ----tgcgcggccgcgcagg------------------------------
A0A2I2YVQ5_PMAIP1-      ----tatccaaactcttctg------------------------------
A0A2I2YVQ5_PMAIP1-      ----tatccaaactcttctg------------------------------
A0A2I2YQ13_BCL2L11      --gctgtctcgatcctccag---------------------tgggtattt
A0A2I2YQ13_BCL2L11      --gctgtctcgatcctccag---------------------tgggtattt
A0A2I2Z168_BMF-02       --------------------------------------------------
A0A2I2Z168_BMF-01       agattgcccgaaagcttcagtgcattgcagaccagttccaccggcttcat
A0A2I2Z8C7_BAD-02       ----tgcggcaaagctccag--------------------ctggacgcga
A0A2I2Z8C7_BAD-01       ----tgcggcaaagctccag--------------------ctggacgcga
A0A2I2Z8C7_BAD-03       ----tgcggcaaagctccag--------------------ctggacgcga
                                                                          

G3QCT2_BIK-01           -----ctggcgctgctgctgcc--------gctgctcagtgggggcct--
G3QTJ6_HRK-01           ---tggcggcgctggcgg------------cctgg---------------
A0A2I2YVQ5_PMAIP1-      --ctcaggaacctga-----------------------------------
A0A2I2YVQ5_PMAIP1-      --ctcaggaacctgactgcatc---aaaaacttgcatgaggggactcc--
A0A2I2YQ13_BCL2L11      ctcttttgacacagacaggagcccagcacccatgagttgtgacaaatcaa
A0A2I2YQ13_BCL2L11      ctcttttgacacagacaggagcccagcacccatgagttgtgacaaatcaa
A0A2I2Z168_BMF-02       ---------caccagcagaacc---aaaatcgtgtgtggtggcagatc--
A0A2I2Z168_BMF-01       gtgcagcaacaccagcagaacc---aaaatcgtgtgtggtggcagatc--
A0A2I2Z8C7_BAD-02       gtcttccagtcctggtgggatc---ggaa-cttgggcaggggaagctc--
A0A2I2Z8C7_BAD-01       gtcttccagtcctggtgggatc---ggaa-cttgggcaggggaagctc--
A0A2I2Z8C7_BAD-03       gtcttccagtcctggtgggatc---ggaa-cttgggcaggggaagctc--
                                   *                                      

G3QCT2_BIK-01           ---------------gcacctgctgctcaagtga----------------
G3QTJ6_HRK-01           -------------------ctgctcggcaggcggaacttgtag-------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------ttcaaaagagttttctcaggaggtgcacatttcatcagtttg
A0A2I2YQ13_BCL2L11      cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgca
A0A2I2YQ13_BCL2L11      cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgca
A0A2I2Z168_BMF-02       ctcctcttcctgcacaaccttgctttgaatggagaa--------------
A0A2I2Z168_BMF-01       ctcctcttcctgcacaaccttgctttgaatggagaa--------------
A0A2I2Z8C7_BAD-02       cgccccctcccagtga----------------------------------
A0A2I2Z8C7_BAD-01       cgccccctcccagtga----------------------------------
A0A2I2Z8C7_BAD-03       cgccccctcccagtgaccttcgctgcacatcccgaaactccacccgttcc
                                                                          

G3QCT2_BIK-01           --------------------------------------------------
G3QTJ6_HRK-01           --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      aagaaagactgcattgtaattgggaggaatgtgaaggtgcattcatgggt
A0A2I2YQ13_BCL2L11      at------------------------------------------------
A0A2I2YQ13_BCL2L11      at------------------------------------------------
A0A2I2Z168_BMF-02       --------------------------------------------------
A0A2I2Z168_BMF-01       --------------------------------------------------
A0A2I2Z8C7_BAD-02       --------------------------------------------------
A0A2I2Z8C7_BAD-01       --------------------------------------------------
A0A2I2Z8C7_BAD-03       cactgccctgggcagccatcttgaatacgggcggaagtacttccctcagg
                                                                          

G3QCT2_BIK-01           --------------------------------------------------
G3QTJ6_HRK-01           --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      gcccttggaaacggaagatggaatacatcaaagtga--------------
A0A2I2YQ13_BCL2L11      -------ggttagagaaatagaggaagttgtcgtgtag------------
A0A2I2YQ13_BCL2L11      -------gggta---------------tttttgaataa------------
A0A2I2Z168_BMF-02       -------gagaacaggaacggggcaggccctag-----------------
A0A2I2Z168_BMF-01       -------gagaacaggaacggggcaggccctaggtga-------------
A0A2I2Z8C7_BAD-02       --------------------------------------------------
A0A2I2Z8C7_BAD-01       --------------------------------------------------
A0A2I2Z8C7_BAD-03       cctatgcaaaaagaggatccgtgctgtctcctttggagggaaggctgacc
                                                                          

G3QCT2_BIK-01           ------------------------
G3QTJ6_HRK-01           ------------------------
A0A2I2YVQ5_PMAIP1-      ------------------------
A0A2I2YVQ5_PMAIP1-      ------------------------
A0A2I2YQ13_BCL2L11      ------------------------
A0A2I2YQ13_BCL2L11      ------------------------
A0A2I2Z168_BMF-02       ------------------------
A0A2I2Z168_BMF-01       ------------------------
A0A2I2Z8C7_BAD-02       ------------------------
A0A2I2Z8C7_BAD-01       ------------------------
A0A2I2Z8C7_BAD-03       cagattcccttccggtgcgtgtga
                                                

© 1998-2020Legal notice