Dataset for CDS classical BH3-containing proteins of organism Felis catus

[Download (right click)] [Edit] [Sequences] [Repertoires]

10 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A337ST43_BMF-02       --------------------------------------------------
A0A337ST43_BMF-05       atgaccagaaccagcccgggtcagaagaaaaggccaaggtgggagtggct
A0A337ST43_BMF-03       --------------------------------------------------
A0A337ST43_BMF-01       --------------------------------------------------
A0A337ST43_BMF-04       atgaccagaaccagcccgggtcagaagaaaaggccaaggtgggagtggct
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A337SAW2_BAD-01       --------------------------------------------------
A0A337SQ56_HRK-01       --------------------------------------------------
                                                                          

A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A337ST43_BMF-02       --------------------------------------------------
A0A337ST43_BMF-05       ctgggaaggcccagggaggaggtgtggagcctccttgagcagtgaggcag
A0A337ST43_BMF-03       --------------------------------------------------
A0A337ST43_BMF-01       --------------------------------------------------
A0A337ST43_BMF-04       ctgggaaggcccagggaggaggtgtggagcctccttgagcagtgaggcag
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A337SAW2_BAD-01       --------------------------------------------------
A0A337SQ56_HRK-01       --------------------------------------------------
                                                                          

A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A337ST43_BMF-02       --------------------------------------------------
A0A337ST43_BMF-05       gccacatttggggagggtgtcatcctcagtggtactttatcaccaggtcg
A0A337ST43_BMF-03       --------------------------------------------------
A0A337ST43_BMF-01       --------------------------------------------------
A0A337ST43_BMF-04       gccacatttggggagggtgtcatcctcagtggtactttatcaccaggtcg
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A337SAW2_BAD-01       --------------------------------------------------
A0A337SQ56_HRK-01       --------------------------------------------------
                                                                          

A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A337ST43_BMF-02       --------------------------------------------------
A0A337ST43_BMF-05       tttgtcatcagtgtcgggccccacttcccccaggtagaagggaaaggaga
A0A337ST43_BMF-03       --------------------------------------------------
A0A337ST43_BMF-01       --------------------------------------------------
A0A337ST43_BMF-04       tttgtcatcagtgtcgggccccacttcccccaggtagaagggaaaggaga
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A337SAW2_BAD-01       --------------------------------------------------
A0A337SQ56_HRK-01       --------------------------------------------------
                                                                          

A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A337ST43_BMF-02       --------------------------------------------------
A0A337ST43_BMF-05       aaggaaagggggagtccttcaggttcggccttcgggcaggggacagcacc
A0A337ST43_BMF-03       --------------------------------------------------
A0A337ST43_BMF-01       --------------------------------------------------
A0A337ST43_BMF-04       aaggaaagggggagtccttcaggttcggccttcgggcaggggacagcacc
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A337SAW2_BAD-01       --------------------------------------------------
A0A337SQ56_HRK-01       --------------------------------------------------
                                                                          

A0A2I2UX96_BCL2L11      --------------------------------atggcaaagcaac-----
A0A2I2UX96_BCL2L11      --------------------------------atggcaaagcaac-----
A0A337ST43_BMF-02       --------------------------------atggagccgcctcagtgt
A0A337ST43_BMF-05       ccagatgcctgcattgcaccccagcaggggagatggagccgcctcagtgt
A0A337ST43_BMF-03       --------------------------------atggagccgcctcagtgt
A0A337ST43_BMF-01       --------------------------------atggagccgcctcagtgt
A0A337ST43_BMF-04       ccagatgcctgcattgcaccccagcaggggagatggagccgcctcagtgt
A0A337SUX1_PMAIP1-      --------------------------------atg---------------
A0A337SAW2_BAD-01       --------------------------------atggggaccccagagaat
A0A337SQ56_HRK-01       --------------------------------atgtg-------------
                                                        ***               

A0A2I2UX96_BCL2L11      --------------------------cttcagatgtaagttctgagtgtg
A0A2I2UX96_BCL2L11      --------------------------cttcagatgtaagttctgagtgtg
A0A337ST43_BMF-02       gtggag--------------------gagctagaggatgatgtgttccag
A0A337ST43_BMF-05       gtggag--------------------gagctagaggatgatgtgttccag
A0A337ST43_BMF-03       gtggag--------------------gagctagaggatgatgtgttccag
A0A337ST43_BMF-01       gtggag--------------------gagctagaggatgatgtgttccag
A0A337ST43_BMF-04       gtggag--------------------gagctagaggatgatgtgttccag
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A337SAW2_BAD-01       cccttatctgctcccacacacgtcccaggcccagggatgtcgggaactga
A0A337SQ56_HRK-01       -----------------------cccgtgccc------------------
                                                                          

A0A2I2UX96_BCL2L11      acagagaaggtggaca----------------------------------
A0A2I2UX96_BCL2L11      acagagaaggtggaca----------------------------------
A0A337ST43_BMF-02       ccagaggatgtggagccggggacccagcctgggag---------------
A0A337ST43_BMF-05       ccagaggatgtggagccggggacccagcctgggag---------------
A0A337ST43_BMF-03       ccagaggatgtggagccggggacccagcctgggag---------------
A0A337ST43_BMF-01       ccagaggatgtggagccggggacccagcctgggag---------------
A0A337ST43_BMF-04       ccagaggatgtggagccggggacccagcctgggag---------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A337SAW2_BAD-01       gcagcgggaggcgaggaagggacccaggacgaaggcggtaggcagggagc
A0A337SQ56_HRK-01       --------------------------------------------------
                                                                          

A0A2I2UX96_BCL2L11      ----attgcagc-----------------------ctgctgagaggcctc
A0A2I2UX96_BCL2L11      ----attgcagc-----------------------ctgctgagaggcctc
A0A337ST43_BMF-02       ----cttgctgtctgctaacctgtttgcccagagccagctggactgcccc
A0A337ST43_BMF-05       ----cttgctgtctgctaacctgtttgcccagagccagctggactgcccc
A0A337ST43_BMF-03       ----cttgctgtctgctaacctgtttgcccagagccagctggactgcccc
A0A337ST43_BMF-01       ----cttgctgtctgctaacctgtttgcccagagccagctggactgcccc
A0A337ST43_BMF-04       ----cttgctgtctgctaacctgtttgcccagagccagctggactgcccc
A0A337SUX1_PMAIP1-      ----cctgggaagaggacgcgtaagagcgc----gcagccgagcccc---
A0A337SAW2_BAD-01       aagtcccgcggcgggggcggagactgggtcggaagcggccacgccccctg
A0A337SQ56_HRK-01       ----cctgcacc----------------------gcggccgcggcccc--
                               *                           * **       *   

A0A2I2UX96_BCL2L11      ctca----------------------------------------------
A0A2I2UX96_BCL2L11      ctca----------------------------------------------
A0A337ST43_BMF-02       ctcagccat-----------------------------------------
A0A337ST43_BMF-05       ctcagccat-----------------------------------------
A0A337ST43_BMF-03       ctcagccat-----------------------------------------
A0A337ST43_BMF-01       ctcagccat-----------------------------------------
A0A337ST43_BMF-04       ctcagccat-----------------------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A337SAW2_BAD-01       gccagccctggtgacatttcaaaagctgattgggccgggtcggtgacagt
A0A337SQ56_HRK-01       -ccggccgtg----------------------------------------
                                                                          

A0A2I2UX96_BCL2L11      ----------------gctcaggcctggggcc------------------
A0A2I2UX96_BCL2L11      ----------------gctcaggcctggggcc------------------
A0A337ST43_BMF-02       -----------ctgcagctcttccctctcacccactgctgtggt------
A0A337ST43_BMF-05       -----------ctgcagctcttccctctcacccactgctgtggt------
A0A337ST43_BMF-03       -----------ctgcagctcttccctctcacccactgctgtggt------
A0A337ST43_BMF-01       -----------ctgcagctcttccctctcacccactgctgtggt------
A0A337ST43_BMF-04       -----------ctgcagctcttccctctcacccactgctgtggt------
A0A337SUX1_PMAIP1-      ----------------gcgcgggcc-------------------------
A0A337SAW2_BAD-01       tcccgttgcccaggcaactagggccgggctccctcagtactggagggagg
A0A337SQ56_HRK-01       ------tgcgcctgcagcgcgggccg------------------------
                                         *     **                         

A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A337ST43_BMF-02       --------------------------------------------------
A0A337ST43_BMF-05       --------------------------------------------------
A0A337ST43_BMF-03       --------------------------------------------------
A0A337ST43_BMF-01       --------------------------------------------------
A0A337ST43_BMF-04       --------------------------------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A337SAW2_BAD-01       cggcaggcccgggtcaggggcctcgagatcgggcttgggcccagagcatg
A0A337SQ56_HRK-01       --------------------------------------------------
                                                                          

A0A2I2UX96_BCL2L11      ---------cctacctctctacagacagagcagcaaggtaatcctgaagg
A0A2I2UX96_BCL2L11      ---------cctacctctctacagacagagcagca---------------
A0A337ST43_BMF-02       ---------cctgggcttcgacccaccagccaggaagac-----------
A0A337ST43_BMF-05       ---------cctgggcttcgacccaccagccaggaagac-----------
A0A337ST43_BMF-03       ---------cctgggcttcgacccaccagccaggaagac-----------
A0A337ST43_BMF-01       ---------cctgggcttcgacccaccagccaggaagac-----------
A0A337ST43_BMF-04       ---------cctgggcttcgacccaccagccaggaagac-----------
A0A337SUX1_PMAIP1-      ---------ccgg---cagagcccgaagtggaa-----------------
A0A337SAW2_BAD-01       ttccagatcccagagtttgagcccagtgagcaggaagactccagccctac
A0A337SQ56_HRK-01       ---------cctgggtctgcgctcg-------------------------
                                 **          *                            

A0A2I2UX96_BCL2L11      cgaaggggacc------gctgcccccaag-----gcagccctcagggccc
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A337ST43_BMF-02       -----------------aaggccacccag--------accctcagtc---
A0A337ST43_BMF-05       -----------------aaggccacccag--------accctcagtc---
A0A337ST43_BMF-03       -----------------aaggccacccag--------accctcagtc---
A0A337ST43_BMF-01       -----------------aaggccacccag--------accctcagtc---
A0A337ST43_BMF-04       -----------------aaggccacccag--------accctcagtc---
A0A337SUX1_PMAIP1-      -----------------tgtgccatgcag---------------------
A0A337SAW2_BAD-01       ggataggggcctgggccccagccccacaggggaccggccccgcggccctg
A0A337SQ56_HRK-01       -----------------tccgccgcgcag---------ctcacggc----
                                                                          

A0A2I2UX96_BCL2L11      gctggccccaccagccagccccgggccttttgctaccagatccccgtttt
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A337ST43_BMF-02       -----------cggcctccccgag----tcag------------------
A0A337ST43_BMF-05       -----------cggcctccccgag----tcag------------------
A0A337ST43_BMF-03       -----------cggcctccccgag----tcag------------------
A0A337ST43_BMF-01       -----------cggcctccccgag----tcag------------------
A0A337ST43_BMF-04       -----------cggcctccccgag----tcag------------------
A0A337SUX1_PMAIP1-      ------------------ctccggag--attt------------------
A0A337SAW2_BAD-01       gcaagcaccagcggacgaccccaggcctcctc------------------
A0A337SQ56_HRK-01       -----------cgctcggctcaaggc--gctc------------------
                                                                          

A0A2I2UX96_BCL2L11      tcatctttgtcagaagatcctccctgctgtctcgatcctccagtgggtat
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A337ST43_BMF-02       --------------------------------------------------
A0A337ST43_BMF-05       --------------------------------------------------
A0A337ST43_BMF-03       --------------------------------------------------
A0A337ST43_BMF-01       --------------------------------------------------
A0A337ST43_BMF-04       --------------------------------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A337SAW2_BAD-01       --------------------------------------------------
A0A337SQ56_HRK-01       --------------------------------------------------
                                                                          

A0A2I2UX96_BCL2L11      ttctcttttgacacagacaggagcccggcac-------------------
A0A2I2UX96_BCL2L11      --------------agacaggagcccggcac-------------------
A0A337ST43_BMF-02       --------------ggtgtcatgctg------------------------
A0A337ST43_BMF-05       --------------ggtgtcatgctg------------------------
A0A337ST43_BMF-03       --------------ggtgtcatgctg------------------------
A0A337ST43_BMF-01       --------------ggtgtcatgctg------------------------
A0A337ST43_BMF-04       --------------ggtgtcatgctg------------------------
A0A337SUX1_PMAIP1-      --------------ggagacaaactg------------------------
A0A337SAW2_BAD-01       --------------gggga--agctggtcaccagcaggggcagcccgcca
A0A337SQ56_HRK-01       --------------ggcgacgagctg--caccagcg--------------
                                       *       *                          

A0A2I2UX96_BCL2L11      ----------ccatgagttgtgacaaatcaacacaaaccccaagtcctcc
A0A2I2UX96_BCL2L11      ----------ccatgagttgtgacaaatcaacacaaaccccaagtcctcc
A0A337ST43_BMF-02       ----------ccttgtggggtgaccgaa------gaaccccagcgact--
A0A337ST43_BMF-05       ----------ccttgtggggtgaccgaa------gaaccccagcgact--
A0A337ST43_BMF-03       ----------ccttgtggggtgaccgaa------gaaccccagcgact--
A0A337ST43_BMF-01       ----------ccttgtggggtgaccgaa------gaaccccagcgact--
A0A337ST43_BMF-04       ----------ccttgtggggtgaccgaa------gaaccccagcgact--
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A337SAW2_BAD-01       gcagcaaccacca--tggaggcgctggggctgtggagacccggagtcgcc
A0A337SQ56_HRK-01       --------caccatgtggcggcgccgcg----------cgcggagccg--
                                                                          

A0A2I2UX96_BCL2L11      ttgccaggccttcaacc---------------------------------
A0A2I2UX96_BCL2L11      ttgccaggccttcaacc---------------------------------
A0A337ST43_BMF-02       --------------------------------------------------
A0A337ST43_BMF-05       --------------------------------------------------
A0A337ST43_BMF-03       --------------------------------------------------
A0A337ST43_BMF-01       --------------------------------------------------
A0A337ST43_BMF-04       --------------------------------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A337SAW2_BAD-01       acagctcgtaccccgccgggaccgaggaggatgaagggacggaggaggaa
A0A337SQ56_HRK-01       --------------------------------------------------
                                                                          

A0A2I2UX96_BCL2L11      ---------attatctcagtgcaatggcttccatgaggcagcctcaggct
A0A2I2UX96_BCL2L11      ---------attatctcagtgcaatggcttccatgaggcagcctcaggct
A0A337ST43_BMF-02       ---------cttttatg---------------------------------
A0A337ST43_BMF-05       ---------cttttatggcaacgctggctaccggctccctctccctgcca
A0A337ST43_BMF-03       ---------cttttatggcaacgctggctaccggctccctctccctgcca
A0A337ST43_BMF-01       ---------cttttatggcaacgctggctaccggctccctctccctgcca
A0A337ST43_BMF-04       ---------cttttatggcaacgctggctaccggctccctctccctgcca
A0A337SUX1_PMAIP1-      -------------------------------------------------a
A0A337SAW2_BAD-01       gagcccagccctttccggggtcgctcgcgctca--gcgcccc-----cca
A0A337SQ56_HRK-01       ----------------gagggcgccggcgcccggcgcgctcc-----cca
                                                                          

A0A2I2UX96_BCL2L11      gtacccg--cagatatgcgc-ccgg-------------------------
A0A2I2UX96_BCL2L11      gtacccg--cagatatgcgc-ccgg-------------------------
A0A337ST43_BMF-02       --------------------------------------------------
A0A337ST43_BMF-05       gtttccctgcaggcttgccccttggtgagcagccccctgaagggcattgg
A0A337ST43_BMF-03       gtttccctgcaggcttgccccttggtgagcagccccctgaagggcattgg
A0A337ST43_BMF-01       gtttccctgcaggcttgccccttggtgagcagccccctgaagggcattgg
A0A337ST43_BMF-04       gtttccctgcaggcttgccccttggtgagcagccccctgaagggcattgg
A0A337SUX1_PMAIP1-      atttccg--------------acag-------------------------
A0A337SAW2_BAD-01       acctctgggctgccctgcgctacgg-------------------------
A0A337SQ56_HRK-01       cctactggccctggctgtgc-gcgg-------------------------
                                                                          

A0A2I2UX96_BCL2L11      -------------agatatggattgcacaagagttgcggcgtatcggaga
A0A2I2UX96_BCL2L11      -------------agatatggattgcacaagagttgcggcgtatcggaga
A0A337ST43_BMF-02       --------------------------------------------------
A0A337ST43_BMF-05       cagcatcgagcagaggtacagattgcccgaaagcttcagtgcattgcaga
A0A337ST43_BMF-03       cagcatcgagcagaggtacagattgcccgaaagcttcagtgcattgcaga
A0A337ST43_BMF-01       cagcatcgagcagaggtacagattgcccgaaagcttcagtgcattgcaga
A0A337ST43_BMF-04       cagcatcgagcagaggtacagattgcccgaaagcttcagtgcattgcaga
A0A337SUX1_PMAIP1-      --------------------------aagc--------------------
A0A337SAW2_BAD-01       --------------------------ccgcgagctccggaggatgagcga
A0A337SQ56_HRK-01       --------------------------ccgcg-------------------
                                                                          

A0A2I2UX96_BCL2L11      cgaatttaatgcatattac--------------ccaaggagggtcttttt
A0A2I2UX96_BCL2L11      cgaatttaatgcatattac--------------ccaaggagggtcttttt
A0A337ST43_BMF-02       ----------------------------caccagcaaa-accgccgtcga
A0A337ST43_BMF-05       ccagttccatcggcttcatatgcagca-----agtaggcatgggggcttg
A0A337ST43_BMF-03       ccagttccatcggcttcatatgcagca-----agtaggcatgggggcttg
A0A337ST43_BMF-01       ccagttccatcggcttcatatgcagcaacaccagcaaa-accgccgtcga
A0A337ST43_BMF-04       ccagttccatcggcttcatatgcagcaacaccagcaaa-accgccgtcga
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A337SAW2_BAD-01       cgagttccagggctccttcaagggacttccacgcccgaagagcgcgggca
A0A337SQ56_HRK-01       -------cagg---------------------------------------
                                                                          

A0A2I2UX96_BCL2L11      gaataattaccaagcagccgaagc--------------------------
A0A2I2UX96_BCL2L11      gaataattaccaagcagccgaagc--------------------------
A0A337ST43_BMF-02       gtgtg--------gtggcagattctcct-------------------ctt
A0A337ST43_BMF-05       gggcg--------gggggagagtctgctggggctggggggccaggacctg
A0A337ST43_BMF-03       gggcg--------gggggagagtctgctggggctggggggccaggacctg
A0A337ST43_BMF-01       gtgtg--------gtggcagattctcct-------------------ctt
A0A337ST43_BMF-04       gtgtg--------gtggcagattctcct-------------------ctt
A0A337SUX1_PMAIP1-      ttatgaatctgatat--------c--------------------------
A0A337SAW2_BAD-01       cagcgacgcagatgcggcaaagcc--------------------------
A0A337SQ56_HRK-01       tggcggcgctg--gcgg------c--------------------------
                                               *                          

A0A2I2UX96_BCL2L11      -----------ccagccc----caaatgattatcttacgactgttacgtt
A0A2I2UX96_BCL2L11      -----------ccagccc----caaatgattatcttacgactgttacgtt
A0A337ST43_BMF-02       cctacacaac-ctggctt------------tgaatgcagaagagaacagg
A0A337ST43_BMF-05       cctcagcaactctgtctc------------tgc---caggctataccagg
A0A337ST43_BMF-03       cctcagcaactctgtctc------------tgc---caggctataccagg
A0A337ST43_BMF-01       cctacacaac-ctggctt------------tgaatgcagaagagaacagg
A0A337ST43_BMF-04       cctacacaac-ctggctt------------tgaatgcagaagagaacagg
A0A337SUX1_PMAIP1-      -----------caaactc----------------ttccgctcgg----ga
A0A337SAW2_BAD-01       -----------ccagctggacgcgcttcatccagtcctggtgggatcgga
A0A337SQ56_HRK-01       -----------ctggctg-----------------ctcggcagg--cgga
                                   *   *                      *           

A0A2I2UX96_BCL2L11      acatcg--------------------------------------------
A0A2I2UX96_BCL2L11      acatcg--------------------------------------------
A0A337ST43_BMF-02       a-atggggcaggtcccaggtgaggctgggctgccctcctcgcatggggca
A0A337ST43_BMF-05       atat------ggtcccaga------------gtttt------------gg
A0A337ST43_BMF-03       atat------ggtcccaga------------gtttt------------gg
A0A337ST43_BMF-01       a-atggggcaggtcccagg------------acctcaccaggaatgaggg
A0A337ST43_BMF-04       a-atggggcaggtcccagg-------------------------------
A0A337SUX1_PMAIP1-      acctga--------------------------------------------
A0A337SAW2_BAD-01       acttggggagagg-----------------------------------ag
A0A337SQ56_HRK-01       acttgtag------------------------------------------
                        *  *                                              

A0A2I2UX96_BCL2L11      --tccgcctggtatggcgattgcagtga
A0A2I2UX96_BCL2L11      --tccgcctggtatggcgattgcagtga
A0A337ST43_BMF-02       ccacaggaaggacatcagcgaggactga
A0A337ST43_BMF-05       cctcggcta-----tta--------tga
A0A337ST43_BMF-03       cctcggcta-----tta--------tga
A0A337ST43_BMF-01       cctttgtcaaacactgt--------tga
A0A337ST43_BMF-04       -------------------------tga
A0A337SUX1_PMAIP1-      ----------------------------
A0A337SAW2_BAD-01       gctccgccccctcccag--------tga
A0A337SQ56_HRK-01       ----------------------------
                                                    

© 1998-2020Legal notice