Dataset for CDS classical BH3-containing proteins of organism Felis catus

[Download (right click)] [Edit] [Sequences] [Repertoires]

14 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A5F5XUY6_BIK-01       at------------------------------------------------
A0A2I2UX96_BCL2L11      at------------------------------------------------
A0A2I2UX96_BCL2L11      at------------------------------------------------
A0A2I2UX96_BCL2L11      at------------------------------------------------
A0A2I2UX96_BCL2L11      at------------------------------------------------
A0A337ST43_BMF-02       --------------------------------------------------
A0A337ST43_BMF-03       --------------------------------------------------
A0A337ST43_BMF-05       at-------------------------------------------gacca
A0A337ST43_BMF-01       --------------------------------------------------
A0A337ST43_BMF-04       at-------------------------------------------gacca
A0A337SUX1_PMAIP1-      at------------------------------------------------
A0A337SQ56_HRK-01       at------------------------------------------------
A0A337SAW2_BAD-01       atggggaccccagagaatcccttatctgctcccacacacgtcccaggccc
A0A337SJI7_BBC3-01      at-------------------------------------------ggccc
                                                                          

A0A5F5XUY6_BIK-01       -----------gaacttgggagtg--------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A337ST43_BMF-02       --------------------------------------------------
A0A337ST43_BMF-03       --------------------------------------------------
A0A337ST43_BMF-05       gaaccagcccgggtcagaagaaaaggccaaggtgggagtggctctgggaa
A0A337ST43_BMF-01       --------------------------------------------------
A0A337ST43_BMF-04       gaaccagcccgggtcagaagaaaaggccaaggtgggagtggctctgggaa
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A337SQ56_HRK-01       --------------------------------------------------
A0A337SAW2_BAD-01       agggatgtcgggaactgagcagcgggaggcgaggaagggacccaggacga
A0A337SJI7_BBC3-01      gagcacgccagga---gggcagct----------------ccccgga---
                                                                          

A0A5F5XUY6_BIK-01       --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A337ST43_BMF-02       --------------------------------------------------
A0A337ST43_BMF-03       --------------------------------------------------
A0A337ST43_BMF-05       ggcccagggaggaggtgtggagcctccttgagcagtgaggcaggccacat
A0A337ST43_BMF-01       --------------------------------------------------
A0A337ST43_BMF-04       ggcccagggaggaggtgtggagcctccttgagcagtgaggcaggccacat
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A337SQ56_HRK-01       --------------------------------------------------
A0A337SAW2_BAD-01       aggcggtaggcagggag---------------------------------
A0A337SJI7_BBC3-01      -----gcccgtagaggg---------------------------------
                                                                          

A0A5F5XUY6_BIK-01       --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A337ST43_BMF-02       --------------------------------------------------
A0A337ST43_BMF-03       --------------------------------------------------
A0A337ST43_BMF-05       ttggggagggtgtcatcctcagtggtactttatcaccaggtcgtttgtca
A0A337ST43_BMF-01       --------------------------------------------------
A0A337ST43_BMF-04       ttggggagggtgtcatcctcagtggtactttatcaccaggtcgtttgtca
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A337SQ56_HRK-01       --------------------------------------------------
A0A337SAW2_BAD-01       --------------------------------------------------
A0A337SJI7_BBC3-01      --------------------------------------------------
                                                                          

A0A5F5XUY6_BIK-01       --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A337ST43_BMF-02       --------------------------------------------------
A0A337ST43_BMF-03       --------------------------------------------------
A0A337ST43_BMF-05       tcagtgtcgggccccacttcccccaggtagaagggaaaggagaaaggaaa
A0A337ST43_BMF-01       --------------------------------------------------
A0A337ST43_BMF-04       tcagtgtcgggccccacttcccccaggtagaagggaaaggagaaaggaaa
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A337SQ56_HRK-01       --------------------------------------------------
A0A337SAW2_BAD-01       --------------------------------------------------
A0A337SJI7_BBC3-01      --------------------------------------------------
                                                                          

A0A5F5XUY6_BIK-01       -------------------------------------------------g
A0A2I2UX96_BCL2L11      -------------------------------------------------g
A0A2I2UX96_BCL2L11      -------------------------------------------------g
A0A2I2UX96_BCL2L11      -------------------------------------------------g
A0A2I2UX96_BCL2L11      -------------------------------------------------g
A0A337ST43_BMF-02       --------------------------------------------------
A0A337ST43_BMF-03       --------------------------------------------------
A0A337ST43_BMF-05       gggggagtccttcaggttcggccttcgggcaggggacagcaccccagatg
A0A337ST43_BMF-01       --------------------------------------------------
A0A337ST43_BMF-04       gggggagtccttcaggttcggccttcgggcaggggacagcaccccagatg
A0A337SUX1_PMAIP1-      -------------------------------------------------g
A0A337SQ56_HRK-01       -----------------------------------------------gtg
A0A337SAW2_BAD-01       ------------caagtcccgcggcgggggcggagactgggtcggaagcg
A0A337SJI7_BBC3-01      ------------cctggcccgcgacg-----------------------g
                                                                          

A0A5F5XUY6_BIK-01       acacaaacacccagagcacagcaaactggggtaaagccaattgcaaaatc
A0A2I2UX96_BCL2L11      gcaaagcaaccttca------------gatgtaagttctgagtgtgacag
A0A2I2UX96_BCL2L11      gcaaagcaaccttca------------gatgtaagttctgagtgtgacag
A0A2I2UX96_BCL2L11      gcaaagcaaccttca------------gatgtaagttctgagtgtgacag
A0A2I2UX96_BCL2L11      gcaaagcaaccttca------------gatgtaagttctgagtgtgacag
A0A337ST43_BMF-02       -------------------------atggagccgcctcagtgtgtggagg
A0A337ST43_BMF-03       -------------------------atggagccgcctcagtgtgtggagg
A0A337ST43_BMF-05       cctgcattgcaccccagcaggggagatggagccgcctcagtgtgtggagg
A0A337ST43_BMF-01       -------------------------atggagccgcctcagtgtgtggagg
A0A337ST43_BMF-04       cctgcattgcaccccagcaggggagatggagccgcctcagtgtgtggagg
A0A337SUX1_PMAIP1-      cctg----------------------------------------------
A0A337SQ56_HRK-01       cccgtgccccctgcaccgcggc--cgcggcccccc---------------
A0A337SAW2_BAD-01       gccacgccccctggc---cagc--cctggtgacatttcaaaagctgattg
A0A337SJI7_BBC3-01      cccgcgcccctttcccctcagccgcctggtgccctc--------------
                                                                          

A0A5F5XUY6_BIK-01       agtcgccaagagaattcttgtgttgtgcttcctctaggttggagtgtctt
A0A2I2UX96_BCL2L11      ag-----------------------------a----aggtggacaattgc
A0A2I2UX96_BCL2L11      ag-----------------------------a----aggtggacaattgc
A0A2I2UX96_BCL2L11      ag-----------------------------a----aggtggacaattgc
A0A2I2UX96_BCL2L11      ag-----------------------------a----aggtggacaattgc
A0A337ST43_BMF-02       ag-----------------------------ctagaggatgatgtgttcc
A0A337ST43_BMF-03       ag-----------------------------ctagaggatgatgtgttcc
A0A337ST43_BMF-05       ag-----------------------------ctagaggatgatgtgttcc
A0A337ST43_BMF-01       ag-----------------------------ctagaggatgatgtgttcc
A0A337ST43_BMF-04       ag-----------------------------ctagaggatgatgtgttcc
A0A337SUX1_PMAIP1-      gg-----------------------------a----------agag----
A0A337SQ56_HRK-01       gg-----------------------------c----------cgtg----
A0A337SAW2_BAD-01       gg-----------------------------c----------cgggtcgg
A0A337SJI7_BBC3-01      gg-----------------------------c----------cgtg----
                         *                                                

A0A5F5XUY6_BIK-01       gagcaggaaaggacataaaagaaaatctccccacggcctgttttccaaac
A0A2I2UX96_BCL2L11      agcctgctga-gaggcctcctcagctcaggcctggggcccctacctctct
A0A2I2UX96_BCL2L11      agcctgctga-gaggcctcctcagctcaggcctggggcccctacctctct
A0A2I2UX96_BCL2L11      agcctgctga-gaggcctcctcagctcaggcctggggcccctacctctct
A0A2I2UX96_BCL2L11      agcctgctga-gaggcctcctcagctcaggcctggggcccctacctctct
A0A337ST43_BMF-02       agccagaggatgtggagccggggacccagcctgggagctt----------
A0A337ST43_BMF-03       agccagaggatgtggagccggggacccagcctgggagctt----------
A0A337ST43_BMF-05       agccagaggatgtggagccggggacccagcctgggagctt----------
A0A337ST43_BMF-01       agccagaggatgtggagccggggacccagcctgggagctt----------
A0A337ST43_BMF-04       agccagaggatgtggagccggggacccagcctgggagctt----------
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A337SQ56_HRK-01       -------------tgcgcctgcagcgcgggcc------------------
A0A337SAW2_BAD-01       tgacagttcccgttgcccaggcaactagggccgggctccc----------
A0A337SJI7_BBC3-01      -------tcctgcggcctctgcgagcccggcctg---ccc----------
                                                                          

A0A5F5XUY6_BIK-01       gcggaattaggggtccagaggggctaaggaacttgtccggagccaaacgg
A0A2I2UX96_BCL2L11      acagacagagcagcaa----------------------------------
A0A2I2UX96_BCL2L11      acagacagagcagcaa------ggtaatcctgaaggcgaaggggaccgct
A0A2I2UX96_BCL2L11      acagacagagcagcaa------ggtaatcctgaaggcgaaggggaccgct
A0A2I2UX96_BCL2L11      acagacagagcagca-----------------------------------
A0A337ST43_BMF-02       ---------gctgtct------gctaacctgtttgcccagagccagctgg
A0A337ST43_BMF-03       ---------gctgtct------gctaacctgtttgcccagagccagctgg
A0A337ST43_BMF-05       ---------gctgtct------gctaacctgtttgcccagagccagctgg
A0A337ST43_BMF-01       ---------gctgtct------gctaacctgtttgcccagagccagctgg
A0A337ST43_BMF-04       ---------gctgtct------gctaacctgtttgcccagagccagctgg
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A337SQ56_HRK-01       --------------------------------------------------
A0A337SAW2_BAD-01       ---------tcagta-----------------ctggagggaggcggcagg
A0A337SJI7_BBC3-01      ---------gccgcc-----------------c----------ccgccgc
                                                                          

A0A5F5XUY6_BIK-01       ccaagctggactaggacccaggtggcccagcagccgagt---gccccgtg
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      gcccccaaggcagccctcagggcccgctggccccaccagccagccccggg
A0A2I2UX96_BCL2L11      gcccccaaggcagccctcagggcccgctggccccaccagccagccccggg
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A337ST43_BMF-02       actgccccctcagccatctgc--agctcttccctctcacccactgctgtg
A0A337ST43_BMF-03       actgccccctcagccatctgc--agctcttccctctcacccactgctgtg
A0A337ST43_BMF-05       actgccccctcagccatctgc--agctcttccctctcacccactgctgtg
A0A337ST43_BMF-01       actgccccctcagccatctgc--agctcttccctctcacccactgctgtg
A0A337ST43_BMF-04       actgccccctcagccatctgc--agctcttccctctcacccactgctgtg
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A337SQ56_HRK-01       -------------------gcctgggtctgcgctc-------gtcc----
A0A337SAW2_BAD-01       cccgggtcaggggcctcgagatcgggcttgggcccagagcatgttccaga
A0A337SJI7_BBC3-01      ccccgccctgctgcccgccgcctacctctgcgcccccacc--gccccg--
                                                                          

A0A5F5XUY6_BIK-01       gcacagtgtccctgtgcatag------------agaagaaatgtctcacg
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      ccttttgctaccagatccccgtttttcatctttgtcagaagatcctccct
A0A2I2UX96_BCL2L11      ccttttgctaccagatccccgtttttcatctttgtcagaagatcctccct
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A337ST43_BMF-02       gtcctgggcttcgacccacca-----------------------gccagg
A0A337ST43_BMF-03       gtcctgggcttcgacccacca-----------------------gccagg
A0A337ST43_BMF-05       gtcctgggcttcgacccacca-----------------------gccagg
A0A337ST43_BMF-01       gtcctgggcttcgacccacca-----------------------gccagg
A0A337ST43_BMF-04       gtcctgggcttcgacccacca-----------------------gccagg
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A337SQ56_HRK-01       -------------gcc----g-----------------------cgcag-
A0A337SAW2_BAD-01       tcccagagtttgagcccagtg-----------------------agcagg
A0A337SJI7_BBC3-01      -cccgccgtcaccgcc----g-----------------------ccctgg
                                                                          

A0A5F5XUY6_BIK-01       caggacccctctccaggaacgtctttttgagca-ccttcctgcaggagca
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      gctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcc
A0A2I2UX96_BCL2L11      gctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcc
A0A2I2UX96_BCL2L11      ---------------------------------------agacaggagcc
A0A337ST43_BMF-02       aagaca----------------------------aggccacccagaccct
A0A337ST43_BMF-03       aagaca----------------------------aggccacccagaccct
A0A337ST43_BMF-05       aagaca----------------------------aggccacccagaccct
A0A337ST43_BMF-01       aagaca----------------------------aggccacccagaccct
A0A337ST43_BMF-04       aagaca----------------------------aggccacccagaccct
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A337SQ56_HRK-01       --------------------------------------ctcacggccgct
A0A337SAW2_BAD-01       aagactccagccctacggataggggcctgggccccagccccacaggggac
A0A337SJI7_BBC3-01      ggggcccccgct-----------ggcctggg---ggtccccgcag----c
                                                                          

A0A5F5XUY6_BIK-01       tggcccggaagttctggacgttcctggcatgaccgatct-----------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      cggcacccatgagttgtgacaaatcaacacaaaccccaagtcctc-----
A0A2I2UX96_BCL2L11      cggcacccatgagttgtgacaaatcaacacaaaccccaagtcctc-----
A0A2I2UX96_BCL2L11      cggcacccatgagttgtgacaaatcaacacaaaccccaagtcctc-----
A0A337ST43_BMF-02       cagtccggcctccccgagtcagggtgtcatgctgcct-------------
A0A337ST43_BMF-03       cagtccggcctccccgagtcagggtgtcatgctgcct-------------
A0A337ST43_BMF-05       cagtccggcctccccgagtcagggtgtcatgctgcct-------------
A0A337ST43_BMF-01       cagtccggcctccccgagtcagggtgtcatgctgcct-------------
A0A337ST43_BMF-04       cagtccggcctccccgagtcagggtgtcatgctgcct-------------
A0A337SUX1_PMAIP1-      -------------------------gacg---------------------
A0A337SQ56_HRK-01       cggctcaa-------ggcgctcggcgacgagctgcaccagc---------
A0A337SAW2_BAD-01       cggccccgcggccctggcaagcaccagcggacgaccccaggcctc-ctcg
A0A337SJI7_BBC3-01      cggccccgagg----gccgcgccccgacg---gtcctcagccctcactc-
                                                                          

A0A5F5XUY6_BIK-01       --------------------------------------------cgtgga
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------cttgcc
A0A2I2UX96_BCL2L11      --------------------------------------------cttgcc
A0A2I2UX96_BCL2L11      --------------------------------------------cttgcc
A0A337ST43_BMF-02       --------------------------------------------tgtggg
A0A337ST43_BMF-03       --------------------------------------------tgtggg
A0A337ST43_BMF-05       --------------------------------------------tgtggg
A0A337ST43_BMF-01       --------------------------------------------tgtggg
A0A337ST43_BMF-04       --------------------------------------------tgtggg
A0A337SUX1_PMAIP1-      --------------------------------------------cgtaag
A0A337SQ56_HRK-01       ---------------------------------gcacca-----tgtggc
A0A337SAW2_BAD-01       gggaagctggtcaccagcaggggcagcccgccagcagcaaccaccatgga
A0A337SJI7_BBC3-01      ----------tcgccggcag------------agcagca-----cctgga
                                                                          

A0A5F5XUY6_BIK-01       gtactatgatcccgggccctcccctaacagcaacagccccgacgat----
A0A2I2UX96_BCL2L11      -----------------------------------------gc-------
A0A2I2UX96_BCL2L11      aggccttcaaccattatctc------------agtgcaatggc-------
A0A2I2UX96_BCL2L11      aggccttcaaccattatctc------------agtgcaatggc-------
A0A2I2UX96_BCL2L11      aggccttcaaccattatctc------------agtgcaatggc-------
A0A337ST43_BMF-02       gtgac------------cga------------agaaccccagcgactctt
A0A337ST43_BMF-03       gtgac------------cga------------agaaccccagcgactctt
A0A337ST43_BMF-05       gtgac------------cga------------agaaccccagcgactctt
A0A337ST43_BMF-01       gtgac------------cga------------agaaccccagcgactctt
A0A337ST43_BMF-04       gtgac------------cga------------agaaccccagcgactctt
A0A337SUX1_PMAIP1-      agcgc----------gcagc------------cgagcccc----------
A0A337SQ56_HRK-01       ggcgccgcgcgcggagccgg------------agggcgccggcgcc----
A0A337SAW2_BAD-01       ggcgc------tggggctgt------------ggagacccggagtcgcca
A0A337SJI7_BBC3-01      atcgc------cggtgcc-c------------agcgccccgggggccctg
                                                                          

A0A5F5XUY6_BIK-01       --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A337ST43_BMF-02       ttatg---------------------------------------------
A0A337ST43_BMF-03       ttatggcaacgctggctaccggctccctctccctgccagtttccctgcag
A0A337ST43_BMF-05       ttatggcaacgctggctaccggctccctctccctgccagtttccctgcag
A0A337ST43_BMF-01       ttatggcaacgctggctaccggctccctctccctgccagtttccctgcag
A0A337ST43_BMF-04       ttatggcaacgctggctaccggctccctctccctgccagtttccctgcag
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A337SQ56_HRK-01       c------------------------------------------------g
A0A337SAW2_BAD-01       c------------------------------------------------a
A0A337SJI7_BBC3-01      g------------------------------------------------c
                                                                          

A0A5F5XUY6_BIK-01       ----gtggccatgcggctggccttcatcggggacgagatggaggt-----
A0A2I2UX96_BCL2L11      -------ttccatgaggcagcctcaggctgtacccgcagatatgcgcccg
A0A2I2UX96_BCL2L11      -------ttccatgaggcagcctcaggctgtacccgcagatatgcgcccg
A0A2I2UX96_BCL2L11      -------ttccatgaggcagcctcaggctgtacccgcagatatgcgcccg
A0A2I2UX96_BCL2L11      -------ttccatgaggcagcctcaggctgtacccgcagatatgcgcccg
A0A337ST43_BMF-02       --------------------------------------------------
A0A337ST43_BMF-03       gcttgccccttggtgagcagccccctgaagggcattggcagcatcgagca
A0A337ST43_BMF-05       gcttgccccttggtgagcagccccctgaagggcattggcagcatcgagca
A0A337ST43_BMF-01       gcttgccccttggtgagcagccccctgaagggcattggcagcatcgagca
A0A337ST43_BMF-04       gcttgccccttggtgagcagccccctgaagggcattggcagcatcgagca
A0A337SUX1_PMAIP1-      gcgcgggccccggcag--agccc---------------------------
A0A337SQ56_HRK-01       gcgcgctccccacctactggccct-----ggctgtgcgcgg----ccgcg
A0A337SAW2_BAD-01       gctcgtaccccgccgg---gaccg-----aggaggatgaag----ggacg
A0A337SJI7_BBC3-01      gggcggccccacccaggcagcccc-----gggagtccgggg----gga-g
                                                                          

A0A5F5XUY6_BIK-01       gaggtggatgatgccccgc-------------------------------
A0A2I2UX96_BCL2L11      gagatatggattgcacaag-------------------------------
A0A2I2UX96_BCL2L11      gagatatggattgcacaag-------------------------------
A0A2I2UX96_BCL2L11      gagatatggattgcacaag-------------------------------
A0A2I2UX96_BCL2L11      gagatatggattgcacaag-------------------------------
A0A337ST43_BMF-02       --------------------------------------------------
A0A337ST43_BMF-03       gaggtacagattgcccgaa-------------------------------
A0A337ST43_BMF-05       gaggtacagattgcccgaa-------------------------------
A0A337ST43_BMF-01       gaggtacagattgcccgaa-------------------------------
A0A337ST43_BMF-04       gaggtacagattgcccgaa-------------------------------
A0A337SUX1_PMAIP1-      gaagtggaatgtgccatgc-------------------------------
A0A337SQ56_HRK-01       caggtg--------------------------------------------
A0A337SAW2_BAD-01       gaggaggaa-gagcccagccctttccggggtcgctcgcgctcagcgcccc
A0A337SJI7_BBC3-01      gaggagcagtgggcccgg------------------gagatcggggccc-
                                                                          

A0A5F5XUY6_BIK-01       --------------------------gttggcgagctgcccgggatggcc
A0A2I2UX96_BCL2L11      ---------------------------------agttgcggcgtatcg--
A0A2I2UX96_BCL2L11      ---------------------------------agttgcggcgtatcg--
A0A2I2UX96_BCL2L11      ---------------------------------agttgcggcgtatcg--
A0A2I2UX96_BCL2L11      ---------------------------------agttgcggcgtatcg--
A0A337ST43_BMF-02       --------------------------------------------------
A0A337ST43_BMF-03       ---------------------------------agcttcagtgcattg--
A0A337ST43_BMF-05       ---------------------------------agcttcagtgcattg--
A0A337ST43_BMF-01       ---------------------------------agcttcagtgcattg--
A0A337ST43_BMF-04       ---------------------------------agcttcagtgcattg--
A0A337SUX1_PMAIP1-      ---------------------------------agctccggagatttg--
A0A337SQ56_HRK-01       --------------------------------------------------
A0A337SAW2_BAD-01       ccaacctctgggctgccctgcgctacggccgcgagctccggaggatga--
A0A337SJI7_BBC3-01      ---------------------------------agctgcggcggatgg--
                                                                          

A0A5F5XUY6_BIK-01       gtgtacagcttggccttcacctacaaccagacgggcctgagaggtgttct
A0A2I2UX96_BCL2L11      ---------------------------gagacgaatttaat---------
A0A2I2UX96_BCL2L11      ---------------------------gagacgaatttaat---------
A0A2I2UX96_BCL2L11      ---------------------------gagacgaatttaat---------
A0A2I2UX96_BCL2L11      ---------------------------gagacgaatttaat---------
A0A337ST43_BMF-02       --------------------------------------------------
A0A337ST43_BMF-03       ---------------------------cagaccagttccatcggcttcat
A0A337ST43_BMF-05       ---------------------------cagaccagttccatcggcttcat
A0A337ST43_BMF-01       ---------------------------cagaccagttccatcggcttcat
A0A337ST43_BMF-04       ---------------------------cagaccagttccatcggcttcat
A0A337SUX1_PMAIP1-      ---------------------------gagacaaact-------------
A0A337SQ56_HRK-01       --------------------------------------------------
A0A337SAW2_BAD-01       ---------------------------gcgacgagttccagggctccttc
A0A337SJI7_BBC3-01      ---------------------------cggacga------------cctc
                                                                          

A0A5F5XUY6_BIK-01       cagaagtctcatgg-----atggtctggccaacctcagggagaacatatg
A0A2I2UX96_BCL2L11      ----------------------------gcatattacccaaggagg----
A0A2I2UX96_BCL2L11      ----------------------------gcatattacccaaggagg----
A0A2I2UX96_BCL2L11      ----------------------------gcatattacccaaggagggtct
A0A2I2UX96_BCL2L11      ----------------------------gcatattacccaaggagggtct
A0A337ST43_BMF-02       -----------------------caccagcaaa-accgccgtcgagtgtg
A0A337ST43_BMF-03       atgca--------------gca-----agtaggcatgggggcttggggcg
A0A337ST43_BMF-05       atgca--------------gca-----agtaggcatgggggcttggggcg
A0A337ST43_BMF-01       atgca--------------gcaacaccagcaaa-accgccgtcgagtgtg
A0A337ST43_BMF-04       atgca--------------gcaacaccagcaaa-accgccgtcgagtgtg
A0A337SUX1_PMAIP1-      -------------------gaatttccgacaga---agcttatgaatctg
A0A337SQ56_HRK-01       -------------------gcggcgctggcg-------------------
A0A337SAW2_BAD-01       aagggacttccacgcccgaagagcgcgggcaca---gcgacgcagatgcg
A0A337SJI7_BBC3-01      aacgcgct-----gtacgagcggcggagaca-a---gaggagcagcagcg
                                                                          

A0A5F5XUY6_BIK-01       gatctggggcttcctgaccctcaggaacagggtgtcccc----caactcg
A0A2I2UX96_BCL2L11      -ctggcaagggtacc-----------------------------------
A0A2I2UX96_BCL2L11      -ttaga--------------------------------------------
A0A2I2UX96_BCL2L11      ttttgaataattaccaagcagccgaagcccagccccaaatgattatctta
A0A2I2UX96_BCL2L11      ttttgaataattaccaagcagccgaagcccagccccaaatgattatctta
A0A337ST43_BMF-02       gtggcagattctcct-------------------cttcctacacaac-ct
A0A337ST43_BMF-03       gggggagagtctgctggggctggggggccaggacctgcctcagcaactct
A0A337ST43_BMF-05       gggggagagtctgctggggctggggggccaggacctgcctcagcaactct
A0A337ST43_BMF-01       gtggcagattctcct-------------------cttcctacacaac-ct
A0A337ST43_BMF-04       gtggcagattctcct-------------------cttcctacacaac-ct
A0A337SUX1_PMAIP1-      atatccaaactcttc----------cgctcg-------------------
A0A337SQ56_HRK-01       --------gcctggc----------tgctcggcagg--------------
A0A337SAW2_BAD-01       gca---aagccc--c----------agctggacgcgcttcatccagtcc-
A0A337SJI7_BBC3-01      aca---ccgcccctc----------accctggagggtcctgtacaatctc
                                                                          

A0A5F5XUY6_BIK-01       gggcgcgggctggcgctgtccctgctgctgctggtgttgctgctgggctg
A0A2I2UX96_BCL2L11      -----ggcatcctacatc------------------------tga-----
A0A2I2UX96_BCL2L11      --------------------------------------gcaatag-----
A0A2I2UX96_BCL2L11      cgactgttacgttacatcgtccgcctggtatggcgattgcagtga-----
A0A2I2UX96_BCL2L11      cgactgttacgttacatcgtccgcctggtatggcgattgcagtga-----
A0A337ST43_BMF-02       ggctttgaatgcagaagagaacagga-atggggcaggtcccaggtgaggc
A0A337ST43_BMF-03       gtctctgc---caggctataccaggatat------ggtcccaga------
A0A337ST43_BMF-05       gtctctgc---caggctataccaggatat------ggtcccaga------
A0A337ST43_BMF-01       ggctttgaatgcagaagagaacagga-atggggcaggtcccagg------
A0A337ST43_BMF-04       ggctttgaatgcagaagagaacagga-atggggcaggtcccagg------
A0A337SUX1_PMAIP1-      ----------------------------------ggaacctga-------
A0A337SQ56_HRK-01       ---------------------------------cggaacttg--------
A0A337SAW2_BAD-01       -tggtgggat-----------------------cggaacttggggagagg
A0A337SJI7_BBC3-01      atcatgggactcctgcccttacccag-ggcccgcggggccccggagatgg
                                                                          

A0A5F5XUY6_BIK-01       ggggctccacctcctccagtga----------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A2I2UX96_BCL2L11      --------------------------------------------------
A0A337ST43_BMF-02       tgggctgccctcctcgcatggggcaccacaggaaggacatcagcgaggac
A0A337ST43_BMF-03       ------gtttt------------ggcctcggcta-----tta--------
A0A337ST43_BMF-05       ------gtttt------------ggcctcggcta-----tta--------
A0A337ST43_BMF-01       ------acctcaccaggaatgagggcctttgtcaaacactgt--------
A0A337ST43_BMF-04       --------------------------------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
A0A337SQ56_HRK-01       --------------------tag---------------------------
A0A337SAW2_BAD-01       aggctccgccccctcccagtga----------------------------
A0A337SJI7_BBC3-01      ag------------cccaattag---------------------------
                                                                          

A0A5F5XUY6_BIK-01       ---
A0A2I2UX96_BCL2L11      ---
A0A2I2UX96_BCL2L11      ---
A0A2I2UX96_BCL2L11      ---
A0A2I2UX96_BCL2L11      ---
A0A337ST43_BMF-02       tga
A0A337ST43_BMF-03       tga
A0A337ST43_BMF-05       tga
A0A337ST43_BMF-01       tga
A0A337ST43_BMF-04       tga
A0A337SUX1_PMAIP1-      ---
A0A337SQ56_HRK-01       ---
A0A337SAW2_BAD-01       ---
A0A337SJI7_BBC3-01      ---
                           

© 1998-2022Legal notice