Dataset for CDS classical BH3-containing proteins of organism Felis catus

[Download (right click)] [Alignment] [Repertoires]

14 sequence(s)

>gnl|bcl2dbcds|A0A2I2UX96_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Felis catus GN=BCL2L11 (length=591 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagagcagcaaggtaatcctgaaggcgaaggggaccgctgcccccaag
gcagccctcagggcccgctggccccaccagccagccccgggccttttgctaccagatccccgtttttcatctttgtcaga
agatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagcctc
aggctgtacccgcagatatgcgcccggagatatggattgcacaagagttgcggcgtatcggagacgaatttaatgcatat
tacccaaggagggtctttttgaataattaccaagcagccgaagcccagccccaaatgattatcttacgactgttacgtta
catcgtccgcctggtatggcgattgcagtga
>gnl|bcl2dbcds|A0A2I2UX96_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Felis catus GN=BCL2L11 (length=504 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagagcagcaaggtaatcctgaaggcgaaggggaccgctgcccccaag
gcagccctcagggcccgctggccccaccagccagccccgggccttttgctaccagatccccgtttttcatctttgtcaga
agatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagcctc
aggctgtacccgcagatatgcgcccggagatatggattgcacaagagttgcggcgtatcggagacgaatttaatgcatat
tacccaaggaggttagagcaatag
>gnl|bcl2dbcds|A0A2I2UX96_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Felis catus GN=BCL2L11 (length=423 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagagcagcaagacaggagcccggcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagcctcaggctgta
cccgcagatatgcgcccggagatatggattgcacaagagttgcggcgtatcggagacgaatttaatgcatattacccaag
gagggtctttttgaataattaccaagcagccgaagcccagccccaaatgattatcttacgactgttacgttacatcgtcc
gcctggtatggcgattgcagtga
>gnl|bcl2dbcds|A0A2I2UX96_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Felis catus GN=BCL2L11 (length=264 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagagcagcaagcttccatgaggcagcctcaggctgtacccgcagata
tgcgcccggagatatggattgcacaagagttgcggcgtatcggagacgaatttaatgcatattacccaaggaggctggca
agggtaccggcatcctacatctga
>gnl|bcl2dbcds|A0A337SAW2_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Felis catus GN=BAD (length=822 residues).
atggggaccccagagaatcccttatctgctcccacacacgtcccaggcccagggatgtcgggaactgagcagcgggaggc
gaggaagggacccaggacgaaggcggtaggcagggagcaagtcccgcggcgggggcggagactgggtcggaagcggccac
gccccctggccagccctggtgacatttcaaaagctgattgggccgggtcggtgacagttcccgttgcccaggcaactagg
gccgggctccctcagtactggagggaggcggcaggcccgggtcaggggcctcgagatcgggcttgggcccagagcatgtt
ccagatcccagagtttgagcccagtgagcaggaagactccagccctacggataggggcctgggccccagccccacagggg
accggccccgcggccctggcaagcaccagcggacgaccccaggcctcctcggggaagctggtcaccagcaggggcagccc
gccagcagcaaccaccatggaggcgctggggctgtggagacccggagtcgccacagctcgtaccccgccgggaccgagga
ggatgaagggacggaggaggaagagcccagccctttccggggtcgctcgcgctcagcgccccccaacctctgggctgccc
tgcgctacggccgcgagctccggaggatgagcgacgagttccagggctccttcaagggacttccacgcccgaagagcgcg
ggcacagcgacgcagatgcggcaaagccccagctggacgcgcttcatccagtcctggtgggatcggaacttggggagagg
aggctccgccccctcccagtga
>gnl|bcl2dbcds|A0A337SJI7_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Felis catus GN=BBC3 (length=582 residues).
atggcccgagcacgccaggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgcgcccctttcccct
cagccgcctggtgccctcggccgtgtcctgcggcctctgcgagcccggcctgcccgccgcccccgccgcccccgccctgc
tgcccgccgcctacctctgcgcccccaccgccccgcccgccgtcaccgccgccctggggggcccccgctggcctgggggt
ccccgcagccggccccgagggccgcgccccgacggtcctcagccctcactctcgccggcagagcagcacctggaatcgcc
ggtgcccagcgccccgggggccctggcgggcggccccacccaggcagccccgggagtccggggggaggaggagcagtggg
cccgggagatcggggcccagctgcggcggatggcggacgacctcaacgcgctgtacgagcggcggagacaagaggagcag
cagcgacaccgcccctcaccctggagggtcctgtacaatctcatcatgggactcctgcccttacccagggcccgcggggc
cccggagatggagcccaattag
>gnl|bcl2dbcds|A0A337SQ56_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Felis catus GN=HRK (length=276 residues).
atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgcctgcagcgcgggccgcctgggtctgcgctc
gtccgccgcgcagctcacggccgctcggctcaaggcgctcggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccggcgcccggcgcgctccccacctactggccctggctgtgcgcggccgcgcaggtggcggcg
ctggcggcctggctgctcggcaggcggaacttgtag
>gnl|bcl2dbcds|A0A337SUX1_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Felis catus GN=PMAIP1 (length=165 residues).
atgcctgggaagaggacgcgtaagagcgcgcagccgagccccgcgcgggccccggcagagcccgaagtggaatgtgccat
gcagctccggagatttggagacaaactgaatttccgacagaagcttatgaatctgatatccaaactcttccgctcgggaa
cctga
>gnl|bcl2dbcds|A0A5F5XUY6_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Felis catus GN=BIK (length=738 residues).
atgaacttgggagtggacacaaacacccagagcacagcaaactggggtaaagccaattgcaaaatcagtcgccaagagaa
ttcttgtgttgtgcttcctctaggttggagtgtcttgagcaggaaaggacataaaagaaaatctccccacggcctgtttt
ccaaacgcggaattaggggtccagaggggctaaggaacttgtccggagccaaacggccaagctggactaggacccaggtg
gcccagcagccgagtgccccgtggcacagtgtccctgtgcatagagaagaaatgtctcacgcaggacccctctccaggaa
cgtctttttgagcaccttcctgcaggagcatggcccggaagttctggacgttcctggcatgaccgatctcgtggagtact
atgatcccgggccctcccctaacagcaacagccccgacgatgtggccatgcggctggccttcatcggggacgagatggag
gtgaggtggatgatgccccgcgttggcgagctgcccgggatggccgtgtacagcttggccttcacctacaaccagacggg
cctgagaggtgttctcagaagtctcatggatggtctggccaacctcagggagaacatatggatctggggcttcctgaccc
tcaggaacagggtgtcccccaactcggggcgcgggctggcgctgtccctgctgctgctggtgttgctgctgggctggggg
ctccacctcctccagtga
>gnl|bcl2dbcds|A0A5F5Y0M2_BMF-05 Bcl2 modifying factor gene OS=[Eukaryota] Felis catus GN=BMF (length=864 residues).
atgaccagaaccagcccgggtcagaagaaaaggccaaggtgggagtggctctgggaaggcccagggaggaggtgtggagc
ctccttgagcagtgaggcaggccacatttggggagggtgtcatcctcagtggtactttatcaccaggtcgtttgtcatca
gtgtcgggccccacttcccccaggtagaagggaaaggagaaaggaaagggggagtccttcaggttcggccttcgggcagg
ggacagcaccccagatgcctgcattgcaccccagcaggggagatggagccgcctcagtgtgtggaggagctagaggatga
tgtgttccagccagaggatgtggagccggggacccagcctgggagcttgctgtctgctaacctgtttgcccagagccagc
tggactgccccctcagccatctgcagctcttccctctcacccactgctgtggtcctgggcttcgacccaccagccaggaa
gacaaggccacccagaccctcagtccggcctccccgagtcagggtgtcatgctgccttgtggggtgaccgaagaacccca
gcgactcttttatggcaacgctggctaccggctccctctccctgccagtttccctgcaggcttgccccttggtgagcagc
cccctgaagggcattggcagcatcgagcagaggtacagattgcccgaaagcttcagtgcattgcagaccagttccatcgg
cttcatatgcagcaagtaggcatgggggcttggggcggggggagagtctgctggggctggggggccaggacctgcctcag
caactctgtctctgccaggctataccaggatatggtcccagagttttggcctcggctattatga
>gnl|bcl2dbcds|A0A5F5Y0M2_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Felis catus GN=BMF (length=591 residues).
atggagccgcctcagtgtgtggaggagctagaggatgatgtgttccagccagaggatgtggagccggggacccagcctgg
gagcttgctgtctgctaacctgtttgcccagagccagctggactgccccctcagccatctgcagctcttccctctcaccc
actgctgtggtcctgggcttcgacccaccagccaggaagacaaggccacccagaccctcagtccggcctccccgagtcag
ggtgtcatgctgccttgtggggtgaccgaagaaccccagcgactcttttatggcaacgctggctaccggctccctctccc
tgccagtttccctgcaggcttgccccttggtgagcagccccctgaagggcattggcagcatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccatcggcttcatatgcagcaacaccagcaaaaccgccgtcgagtgtgg
tggcagattctcctcttcctacacaacctggctttgaatgcagaagagaacaggaatggggcaggtcccaggacctcacc
aggaatgagggcctttgtcaaacactgttga
>gnl|bcl2dbcds|A0A5F5Y0M2_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Felis catus GN=BMF (length=450 residues).
atggagccgcctcagtgtgtggaggagctagaggatgatgtgttccagccagaggatgtggagccggggacccagcctgg
gagcttgctgtctgctaacctgtttgcccagagccagctggactgccccctcagccatctgcagctcttccctctcaccc
actgctgtggtcctgggcttcgacccaccagccaggaagacaaggccacccagaccctcagtccggcctccccgagtcag
ggtgtcatgctgccttgtggggtgaccgaagaaccccagcgactcttttatgcaccagcaaaaccgccgtcgagtgtggt
ggcagattctcctcttcctacacaacctggctttgaatgcagaagagaacaggaatggggcaggtcccaggtgaggctgg
gctgccctcctcgcatggggcaccacaggaaggacatcagcgaggactga
>gnl|bcl2dbcds|A0A5F5Y0M2_BMF-03 Bcl2 modifying factor gene OS=[Eukaryota] Felis catus GN=BMF (length=582 residues).
atggagccgcctcagtgtgtggaggagctagaggatgatgtgttccagccagaggatgtggagccggggacccagcctgg
gagcttgctgtctgctaacctgtttgcccagagccagctggactgccccctcagccatctgcagctcttccctctcaccc
actgctgtggtcctgggcttcgacccaccagccaggaagacaaggccacccagaccctcagtccggcctccccgagtcag
ggtgtcatgctgccttgtggggtgaccgaagaaccccagcgactcttttatggcaacgctggctaccggctccctctccc
tgccagtttccctgcaggcttgccccttggtgagcagccccctgaagggcattggcagcatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccatcggcttcatatgcagcaagtaggcatgggggcttggggcgggggg
agagtctgctggggctggggggccaggacctgcctcagcaactctgtctctgccaggctataccaggatatggtcccaga
gttttggcctcggctattatga
>gnl|bcl2dbcds|A0A5F5Y0M2_BMF-04 Bcl2 modifying factor gene OS=[Eukaryota] Felis catus GN=BMF (length=837 residues).
atgaccagaaccagcccgggtcagaagaaaaggccaaggtgggagtggctctgggaaggcccagggaggaggtgtggagc
ctccttgagcagtgaggcaggccacatttggggagggtgtcatcctcagtggtactttatcaccaggtcgtttgtcatca
gtgtcgggccccacttcccccaggtagaagggaaaggagaaaggaaagggggagtccttcaggttcggccttcgggcagg
ggacagcaccccagatgcctgcattgcaccccagcaggggagatggagccgcctcagtgtgtggaggagctagaggatga
tgtgttccagccagaggatgtggagccggggacccagcctgggagcttgctgtctgctaacctgtttgcccagagccagc
tggactgccccctcagccatctgcagctcttccctctcacccactgctgtggtcctgggcttcgacccaccagccaggaa
gacaaggccacccagaccctcagtccggcctccccgagtcagggtgtcatgctgccttgtggggtgaccgaagaacccca
gcgactcttttatggcaacgctggctaccggctccctctccctgccagtttccctgcaggcttgccccttggtgagcagc
cccctgaagggcattggcagcatcgagcagaggtacagattgcccgaaagcttcagtgcattgcagaccagttccatcgg
cttcatatgcagcaacaccagcaaaaccgccgtcgagtgtggtggcagattctcctcttcctacacaacctggctttgaa
tgcagaagagaacaggaatggggcaggtcccaggtga
© 1998-2020Legal notice