Dataset for CDS classical BH3-containing proteins of organism Electrophorus electricus

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A4W4H0G9_PMAIP1-      --------------------------------------------------
A0A4W4H3Y1_BCL2L11      cgcatacg------------------------------------------
A0A4W4H3Y1_BCL2L11      ---atacg------------------------------------------
A0A4W4DZH9_BMF-01       ---atggatgacgaa--------gaggatgatgtgttcagga--------
A0A4W4DXF5_BAD-01       ---atgcacaatcaatatttgttga--------gattgaggaaagcgaat
A0A4W4HE29_BAD-01       ---atgtttaa-cagcagct-ttgacttcgatcggttgagaaaag----t

A0A4W4H0G9_PMAIP1-      -----------------------------------------aaacaagca
A0A4W4H3Y1_BCL2L11      ---------gcaaaaccgggccaatggcccagccttc--ttaaaggagca
A0A4W4H3Y1_BCL2L11      ---------gcaaaaccgggccaatggcccagccttc--ttaaaggagca
A0A4W4DZH9_BMF-01       --ttgccgcacagtactggccacact--ccctccgtgagataaagcaaga
A0A4W4DXF5_BAD-01       tttactcgcgaggattataaaaaagtaatca-----aggccaaaacactg
A0A4W4HE29_BAD-01       ttgtgcggcgcgtcaccgagaacaacaaccacccgcagaccaaacgagta
                                                                 ***  *   

A0A4W4H0G9_PMAIP1-      ---ggaact-----------------------------------------
A0A4W4H3Y1_BCL2L11      gggggaaagcgg---------------agaaaacaccggtgtcggaacag
A0A4W4H3Y1_BCL2L11      gggggaaagcgg---------------agaaaacaccggtgtcggaacag
A0A4W4DZH9_BMF-01       ---agagcgtgg-------------------cacacagactgcagggcgg
A0A4W4DXF5_BAD-01       cgtgaagagggagagacaccttc-----gaacacatcg--tgctggaatc
A0A4W4HE29_BAD-01       ---ggagcgttagcgttagctaccgggagttcacatcagccgccggtcag

A0A4W4H0G9_PMAIP1-      ----------agtc------------------------------------
A0A4W4H3Y1_BCL2L11      cctccc----ggcc--------------------------cgaacagttt
A0A4W4H3Y1_BCL2L11      cctccc----ggcc--------------------------cgaacagttt
A0A4W4DZH9_BMF-01       ccactggcgaggcc----------caacgg----------catgctgccg
A0A4W4DXF5_BAD-01       ctttta--g-agtcacagctttcacaatggaaaagg----caccatgt-g
A0A4W4HE29_BAD-01       ctgtca--gaagtc---gttttcacaatggctcagatgttcactatatct
                                   * *                                    

A0A4W4H0G9_PMAIP1-      ----------------------------------ccgtga----------
A0A4W4H3Y1_BCL2L11      gac-------tgctctcatc-------cgaa---ccaagg-ggaccaatt
A0A4W4H3Y1_BCL2L11      gac-------tgctctcatc-------cgaa---ccaagg-ggaccaatt
A0A4W4DZH9_BMF-01       tgcggcgtgtc----------------cgaagagccccgacgcctc----
A0A4W4DXF5_BAD-01       gtcaaagagatg---acatcagtgcattggatgaccaagacgaatcaaga
A0A4W4HE29_BAD-01       gacacagagtcagacacatc-------tgaaggaccagga-gacacagac
                                                          **  *           

A0A4W4H0G9_PMAIP1-      --------------------------------------------------
A0A4W4H3Y1_BCL2L11      taggggagggattacaagtagtct--------------------------
A0A4W4H3Y1_BCL2L11      taggggagggattacaagtagtct--------------------------
A0A4W4DZH9_BMF-01       -ttctacggtagtgcaggactgct--------------------------
A0A4W4DXF5_BAD-01       tggtcagagacaatcgagagtgatgactcccctcgaatcagcaatcatca
A0A4W4HE29_BAD-01       cagcaaggggacagcaaggaagctg-----------------agccttca

A0A4W4H0G9_PMAIP1-      --------------------cacca-------------------------
A0A4W4H3Y1_BCL2L11      --ttctg-----------gttacca----------ttcaaggtcgcctct
A0A4W4H3Y1_BCL2L11      --ttctg-----------gttacca----------ttcaaggtcgcctct
A0A4W4DZH9_BMF-01       ---cctgct---------agcacca-------------------------
A0A4W4DXF5_BAD-01       catcatgccaaacaacacagcaacagaggtcgggggtcgtgtgcggctct
A0A4W4HE29_BAD-01       cagtctg-----------agcaaca-------------------------
                                             * **                         

A0A4W4H0G9_PMAIP1-      --------------------------------------------------
A0A4W4H3Y1_BCL2L11      attccgaactctctccagatcctcgagtggatatttttcgttcgacagtg
A0A4W4H3Y1_BCL2L11      attccgaactctctccagatcctcgagtggatatttttcgttcgacagtg
A0A4W4DZH9_BMF-01       ---------cctgcacgccccaacagtg----------cagacgacgcca
A0A4W4DXF5_BAD-01       actccgagtcccaggcataca--cagtgagccact---gggaagacactg
A0A4W4HE29_BAD-01       ---------cctacacgtacc--taata---cact---cagaggagaatg

A0A4W4H0G9_PMAIP1-      ------------------------------tgtcaattaatttcttggct
A0A4W4H3Y1_BCL2L11      agcc------------aagctctccactaatgacacatagcacgtctact
A0A4W4H3Y1_BCL2L11      agcc------------aagctctccactaatgacacatagcacgtctact
A0A4W4DZH9_BMF-01       tgctcccaga---------------------------gaaccagctggct
A0A4W4DXF5_BAD-01       agtcccaagatggagt-gtcagcagaagagggtggaggagcttgtga---
A0A4W4HE29_BAD-01       gacggcgaggcagaggaatcactcaatgaatgaggcggagcttcaggact

A0A4W4H0G9_PMAIP1-      t--------------tccgacctctttctagagcaaaccgttgtgt----
A0A4W4H3Y1_BCL2L11      caaactccgagtccatctagtcaagtgataattcacgccctgcaacgcat
A0A4W4H3Y1_BCL2L11      caaactccgagtccatctagtcaagtgataattcacgccctgcaac----
A0A4W4DZH9_BMF-01       gtggagcc-------tccccggcgg---------aggcccctccat----
A0A4W4DXF5_BAD-01       -aggagcc---ccattccgtggccgatcccagtctgctcctgctgc----
A0A4W4HE29_BAD-01       caggagctgagtctttccgtcgtcgttcccgttcagctcccccaat----
                                       **                     *           

A0A4W4H0G9_PMAIP1-      --------------------------------------------------
A0A4W4H3Y1_BCL2L11      ttccgaagcgcaaggcaacggtcaaaattatgagttatggaccggacccc
A0A4W4H3Y1_BCL2L11      --------------------------------------------------
A0A4W4DZH9_BMF-01       --------------------------------------------------
A0A4W4DXF5_BAD-01       --------------------------------------------------
A0A4W4HE29_BAD-01       --------------------------------------------------

A0A4W4H0G9_PMAIP1-      ---------------------------------------ctgaatgtgcg
A0A4W4H3Y1_BCL2L11      ctaatgaagcgttgtctgtgagggacatgcgagcggagttgtacgtcgcg
A0A4W4H3Y1_BCL2L11      ---------------------------------cggagttgtacgtcgcg
A0A4W4DZH9_BMF-01       -------------------------agcgtgga-ggccagca---ttggt
A0A4W4DXF5_BAD-01       -------------------------actatggaaagccaagaaatatgga
A0A4W4HE29_BAD-01       -------------------------tctgtgggcagccaagaaatatggc

A0A4W4H0G9_PMAIP1-      tgccagctgcgcagaatgggagatctgatcaactggaaatacttgttgct
A0A4W4H3Y1_BCL2L11      caggagctgcggcgcatcggtgatgacttcaaccgaatttattttc----
A0A4W4H3Y1_BCL2L11      caggagctgcggcgcatcggtgatgacttcaaccgaatttattttc----
A0A4W4DZH9_BMF-01       caaaagctccagatgattggcgaccagttctatcaagaacacatgctgca
A0A4W4DXF5_BAD-01       cggcaactgaggaggatgagcgatgagttt-------gacacctggctgg
A0A4W4HE29_BAD-01       agacagttaaggaagatgagcgatgagttt-------gacaccttactgg
                            *  *       **  * **     *           *  *      

A0A4W4H0G9_PMAIP1-      gcatttgattgct--gacgctcgtacacgtctgggaatatgcagtggtaa
A0A4W4H3Y1_BCL2L11      ---------------ggggggtggagaggaatggtggtgcagcccaacag
A0A4W4H3Y1_BCL2L11      ---------------ggggggtg-------atgg---------cttgctt
A0A4W4DZH9_BMF-01       acaccga---aaccaaaggaaccatcagc----------cattttggttg
A0A4W4DXF5_BAD-01       acaaaggggagataagaagagtgagcagccctgggaaactgtcacagaag
A0A4W4HE29_BAD-01       acaaagg---gatgaagagggcaaggagcgcaggagcagctcgtcagatg

A0A4W4H0G9_PMAIP1-      t----------------gatgttgttgctttgtg----------------
A0A4W4H3Y1_BCL2L11      cctgcccagaatgaacccgctttgctgcagtgg----------------a
A0A4W4H3Y1_BCL2L11      tctggcctgtacg-----tttgtggtcctgtgg----------------a
A0A4W4DZH9_BMF-01       cgtttggcctctgcattgtatgtgctcctgt----ttgagagggagcctg
A0A4W4DXF5_BAD-01       cagaccaaccaaggatggttctctttcctttggtgttccaaggaa-----
A0A4W4HE29_BAD-01       cacacatcccccagctggttcgccttcctctggagccacaaagagtcaga
                                                 * *  *                   

A0A4W4H0G9_PMAIP1-      ---------------------------------------------catgt
A0A4W4H3Y1_BCL2L11      ttgggctcctgat------tggacgcctattacagcttctcctgagaaga
A0A4W4H3Y1_BCL2L11      taaatctgtggataaatcctgaccctttatt-----tcctctcacacaat
A0A4W4DZH9_BMF-01       cagctcgctggaggggggtggacca--------------------gaggt
A0A4W4DXF5_BAD-01       ----gaggaaggaag------------------------------aaagt
A0A4W4HE29_BAD-01       caccgagaccagcagcagcgtaacagccccagatacccgccctgcagaat

A0A4W4H0G9_PMAIP1-      ag------------
A0A4W4H3Y1_BCL2L11      agataa--------
A0A4W4H3Y1_BCL2L11      atttaaagctttag
A0A4W4DZH9_BMF-01       ga------------
A0A4W4DXF5_BAD-01       aa------------
A0A4W4HE29_BAD-01       aa------------

© 1998-2021Legal notice