Dataset for CDS classical BH3-containing proteins of organism Electrophorus electricus

[Download (right click)] [Alignment] [Repertoires]

6 sequence(s)

>gnl|bcl2dbcds|A0A4W4DXF5_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Electrophorus electricus GN=BAD (length=630 residues).
atgcacaatcaatatttgttgagattgaggaaagcgaattttactcgcgaggattataaaaaagtaatcaaggccaaaac
actgcgtgaagagggagagacaccttcgaacacatcgtgctggaatccttttagagtcacagctttcacaatggaaaagg
caccatgtggtcaaagagatgacatcagtgcattggatgaccaagacgaatcaagatggtcagagacaatcgagagtgat
gactcccctcgaatcagcaatcatcacatcatgccaaacaacacagcaacagaggtcgggggtcgtgtgcggctctactc
cgagtcccaggcatacacagtgagccactgggaagacactgagtcccaagatggagtgtcagcagaagagggtggaggag
cttgtgaaggagccccattccgtggccgatcccagtctgctcctgctgcactatggaaagccaagaaatatggacggcaa
ctgaggaggatgagcgatgagtttgacacctggctggacaaaggggagataagaagagtgagcagccctgggaaactgtc
acagaagcagaccaaccaaggatggttctctttcctttggtgttccaaggaagaggaaggaagaaagtaa
>gnl|bcl2dbcds|A0A4W4DZH9_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Electrophorus electricus GN=BMF (length=471 residues).
atggatgacgaagaggatgatgtgttcaggattgccgcacagtactggccacactccctccgtgagataaagcaagaaga
gcgtggcacacagactgcagggcggccactggcgaggcccaacggcatgctgccgtgcggcgtgtccgaagagccccgac
gcctcttctacggtagtgcaggactgctcctgctagcaccacctgcacgccccaacagtgcagacgacgccatgctccca
gagaaccagctggctgtggagcctccccggcggaggcccctccatagcgtggaggccagcattggtcaaaagctccagat
gattggcgaccagttctatcaagaacacatgctgcaacaccgaaaccaaaggaaccatcagccattttggttgcgtttgg
cctctgcattgtatgtgctcctgtttgagagggagcctgcagctcgctggaggggggtggaccagaggtga
>gnl|bcl2dbcds|A0A4W4H0G9_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Electrophorus electricus GN=PMAIP1 (length=216 residues).
aaacaagcaggaactagtcccgtgacaccatgtcaattaatttcttggctttccgacctctttctagagcaaaccgttgt
gtctgaatgtgcgtgccagctgcgcagaatgggagatctgatcaactggaaatacttgttgctgcatttgattgctgacg
ctcgtacacgtctgggaatatgcagtggtaatgatgttgttgctttgtgcatgtag
>gnl|bcl2dbcds|A0A4W4H3Y1_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Electrophorus electricus GN=BCL2L11 (length=588 residues).
cgcatacggcaaaaccgggccaatggcccagccttcttaaaggagcagggggaaagcggagaaaacaccggtgtcggaac
agcctcccggcccgaacagtttgactgctctcatccgaaccaaggggaccaatttaggggagggattacaagtagtcttt
ctggttaccattcaaggtcgcctctattccgaactctctccagatcctcgagtggatatttttcgttcgacagtgagcca
agctctccactaatgacacatagcacgtctactcaaactccgagtccatctagtcaagtgataattcacgccctgcaacg
catttccgaagcgcaaggcaacggtcaaaattatgagttatggaccggaccccctaatgaagcgttgtctgtgagggaca
tgcgagcggagttgtacgtcgcgcaggagctgcggcgcatcggtgatgacttcaaccgaatttattttcggggggtggag
aggaatggtggtgcagcccaacagcctgcccagaatgaacccgctttgctgcagtggattgggctcctgattggacgcct
attacagcttctcctgagaagaagataa
>gnl|bcl2dbcds|A0A4W4H3Y1_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Electrophorus electricus GN=BCL2L11 (length=486 residues).
atacggcaaaaccgggccaatggcccagccttcttaaaggagcagggggaaagcggagaaaacaccggtgtcggaacagc
ctcccggcccgaacagtttgactgctctcatccgaaccaaggggaccaatttaggggagggattacaagtagtctttctg
gttaccattcaaggtcgcctctattccgaactctctccagatcctcgagtggatatttttcgttcgacagtgagccaagc
tctccactaatgacacatagcacgtctactcaaactccgagtccatctagtcaagtgataattcacgccctgcaaccgga
gttgtacgtcgcgcaggagctgcggcgcatcggtgatgacttcaaccgaatttattttcggggggtgatggcttgctttc
tggcctgtacgtttgtggtcctgtggataaatctgtggataaatcctgaccctttatttcctctcacacaatatttaaag
ctttag
>gnl|bcl2dbcds|A0A4W4HE29_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Electrophorus electricus GN=BAD (length=618 residues).
atgtttaacagcagctttgacttcgatcggttgagaaaagtttgtgcggcgcgtcaccgagaacaacaaccacccgcaga
ccaaacgagtaggagcgttagcgttagctaccgggagttcacatcagccgccggtcagctgtcagaagtcgttttcacaa
tggctcagatgttcactatatctgacacagagtcagacacatctgaaggaccaggagacacagaccagcaaggggacagc
aaggaagctgagccttcacagtctgagcaacacctacacgtacctaatacactcagaggagaatggacggcgaggcagag
gaatcactcaatgaatgaggcggagcttcaggactcaggagctgagtctttccgtcgtcgttcccgttcagctcccccaa
ttctgtgggcagccaagaaatatggcagacagttaaggaagatgagcgatgagtttgacaccttactggacaaagggatg
aagagggcaaggagcgcaggagcagctcgtcagatgcacacatcccccagctggttcgccttcctctggagccacaaaga
gtcagacaccgagaccagcagcagcgtaacagccccagatacccgccctgcagaataa
© 1998-2020Legal notice