Dataset for CDS classical BH3-containing proteins of organism Denticeps clupeoides

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C4CCV8_PMAIP1-      --------------------------------------------------
A0A8C4BKB8_BAD-01       ---------------------------------------------atgg-
A0A8C4C2E0_BMF-01       ---------------------------------------------atgga
A0A8C4C2E0_BMF-02       atggagggtgtatttatgaggcagcctgtctatgtggaccccctcatgga
                                                                          

A0A8C4CCV8_PMAIP1-      --------------------------------------------------
A0A8C4BKB8_BAD-01       ------------------------------ccca---------catgttc
A0A8C4C2E0_BMF-01       ggatgaggatgaggatgtgttcagtggacacccacacctttggcatactc
A0A8C4C2E0_BMF-02       ggatgaggatgaggatgtgttcagtggacacccacacctttggcatactc
                                                                          

A0A8C4CCV8_PMAIP1-      ------------------------------agaaacctgcagc-------
A0A8C4BKB8_BAD-01       atttcagacagtggctcggactcggatgtgggagacacgaagcggccaga
A0A8C4C2E0_BMF-01       atttcagggag----ataaaatataaggacaggggcacgcagacgccggg
A0A8C4C2E0_BMF-02       atttcagggag----ataaaatataaggacaggggcacgcagacgccggg
                                                       *   *  * **        

A0A8C4CCV8_PMAIP1-      --------------------------------------------------
A0A8C4BKB8_BAD-01       tgc------ctcacggggctcccggtcg-tccgaagtgcccagaaagagg
A0A8C4C2E0_BMF-01       cccggctctctcattgggcaacgggatgctgccattcggcctggcagagg
A0A8C4C2E0_BMF-02       cccggctctctcattgggcaacgggatgctgccattcggcctggcagagg
                                                                          

A0A8C4CCV8_PMAIP1-      --------------------------------------------------
A0A8C4BKB8_BAD-01       ----cagagggtttactc-cgagaaca---------------acgcccc-
A0A8C4C2E0_BMF-01       agcccagacgactctttcacggtaacgcagctttccgtttgcacttccct
A0A8C4C2E0_BMF-02       agcccagacgactctttcacggtaacgcagctttccgtttgcacttccct
                                                                          

A0A8C4CCV8_PMAIP1-      ------------------agcgaaacca----------------------
A0A8C4BKB8_BAD-01       -----------gtgcaagagcgaggccgacttccaggagtttggatctac
A0A8C4C2E0_BMF-01       gcccattttgagcgtgtgggcgaagcca--tgccagaa-----gatcagc
A0A8C4C2E0_BMF-02       gcccattttgagcgtgtgggcgaagcca--tgccagaa-----gatcagc
                                           ****  **                       

A0A8C4CCV8_PMAIP1-      -----------------ccaccgacagcag--------------------
A0A8C4BKB8_BAD-01       ggaggacgagctcctggctgccgacagcggaccttttcggtctcgatccc
A0A8C4C2E0_BMF-01       ag-ggacaggcagatcgtcaccatcagtgg------------ccgag---
A0A8C4C2E0_BMF-02       ag-ggacaggcagatcgtcaccatcagtgg------------ccgag---
                                            **  ***  *                    

A0A8C4CCV8_PMAIP1-      ------------------cccggcgtgctggagtgcgcggtc--cagctg
A0A8C4BKB8_BAD-01       actcggctccccctgccctgtgggccgccaggaagtacggtcagcagctc
A0A8C4C2E0_BMF-01       ------------------tgtggaggcccaga----ttgggcagaagctt
A0A8C4C2E0_BMF-02       ------------------tgtggaggcccaga----ttgggcagaagctt
                                             **    *  *       ** *   **** 

A0A8C4CCV8_PMAIP1-      cgtgaaatcggggac----tttatcaactggaggtaca------------
A0A8C4BKB8_BAD-01       aggaggatgagtgacgagtttgat-atgaagagggtcctcagcgccggaa
A0A8C4C2E0_BMF-01       caaatgattggagaccagttccatcaagaacatgtacagcagcatcacag
A0A8C4C2E0_BMF-02       caaatgattggagaccagttccatcaagaacatgtacagcagcatcacag
                              **  * ***    *  ** *     * *  *             

A0A8C4CCV8_PMAIP1-      -----------aggtgctggacctgctgctgaggaccta-----------
A0A8C4BKB8_BAD-01       ctgccaa--gcagatgcga-acctcctccagctg-gctcggaattctctg
A0A8C4C2E0_BMF-01       aaaccaaaggtggcggcgacagccattcctgtggcgcttggcctttgctt
A0A8C4C2E0_BMF-02       aaaccaaaggtggcggcgacagccattcctgtggcgcttggcctttgctt
                                    *  **   * *   * * *  *  **            

A0A8C4CCV8_PMAIP1-      --------------ctcgaagtcgac--------cgagatcaa-------
A0A8C4BKB8_BAD-01       gagccacaaagag-tccgagggggaggcgaacagcggcctcaaggca---
A0A8C4C2E0_BMF-01       tgtacaccttgatctttgaaagggatgctgttggcg--ttcaagggagag
A0A8C4C2E0_BMF-02       tgtacaccttgatctttgaaagggatgctgttggcg--ttcaagggagag
                                         **    **         **   ****       

A0A8C4CCV8_PMAIP1-      --------------------------------------------------
A0A8C4BKB8_BAD-01       -accggggca----------------------------------------
A0A8C4C2E0_BMF-01       gattggagcagagagccggaggtgtgcgcggcaggcctgttgttagcact
A0A8C4C2E0_BMF-02       gattggagcagag-------------------------------------
                                                                          

A0A8C4CCV8_PMAIP1-      --------------------------------------------------
A0A8C4BKB8_BAD-01       --------------------------------------------------
A0A8C4C2E0_BMF-01       gtcagctatcctggattcacctgtcgaaccactttcttggcaaagactac
A0A8C4C2E0_BMF-02       --------------------------------------------------
                                                                          

A0A8C4CCV8_PMAIP1-      --------------------------------------------------
A0A8C4BKB8_BAD-01       ---cgcacggccaa------------------------------------
A0A8C4C2E0_BMF-01       tgccgcagggccaatgagcacaactgacaggagatgtgggtttcatcata
A0A8C4C2E0_BMF-02       --------------------------------------------------
                                                                          

A0A8C4CCV8_PMAIP1-      ----------------------------gtga
A0A8C4BKB8_BAD-01       ----------------------------gtga
A0A8C4C2E0_BMF-01       taagcgcaggctctacgaataagggactgtaa
A0A8C4C2E0_BMF-02       ----------------------------gtga
                                                    ** *

© 1998-2022Legal notice