Dataset for CDS classical BH3-containing proteins of organism Denticeps clupeoides

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|A0A8C4BKB8_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Denticeps clupeoides GN=BAD (length=441 residues).
atggcccacatgttcatttcagacagtggctcggactcggatgtgggagacacgaagcggccagatgcctcacggggctc
ccggtcgtccgaagtgcccagaaagaggcagagggtttactccgagaacaacgccccgtgcaagagcgaggccgacttcc
aggagtttggatctacggaggacgagctcctggctgccgacagcggaccttttcggtctcgatcccactcggctccccct
gccctgtgggccgccaggaagtacggtcagcagctcaggaggatgagtgacgagtttgatatgaagagggtcctcagcgc
cggaactgccaagcagatgcgaacctcctccagctggctcggaattctctggagccacaaagagtccgagggggaggcga
acagcggcctcaaggcaaccggggcacgcacggccaagtga
>gnl|bcl2dbcds|A0A8C4C2E0_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Denticeps clupeoides GN=BMF (length=636 residues).
atggaggatgaggatgaggatgtgttcagtggacacccacacctttggcatactcatttcagggagataaaatataagga
caggggcacgcagacgccgggcccggctctctcattgggcaacgggatgctgccattcggcctggcagaggagcccagac
gactctttcacggtaacgcagctttccgtttgcacttccctgcccattttgagcgtgtgggcgaagccatgccagaagat
cagcagggacaggcagatcgtcaccatcagtggccgagtgtggaggcccagattgggcagaagcttcaaatgattggaga
ccagttccatcaagaacatgtacagcagcatcacagaaaccaaaggtggcggcgacagccattcctgtggcgcttggcct
ttgctttgtacaccttgatctttgaaagggatgctgttggcgttcaagggagaggattggagcagagagccggaggtgtg
cgcggcaggcctgttgttagcactgtcagctatcctggattcacctgtcgaaccactttcttggcaaagactactgccgc
agggccaatgagcacaactgacaggagatgtgggtttcatcatataagcgcaggctctacgaataagggactgtaa
>gnl|bcl2dbcds|A0A8C4C2E0_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Denticeps clupeoides GN=BMF (length=516 residues).
atggagggtgtatttatgaggcagcctgtctatgtggaccccctcatggaggatgaggatgaggatgtgttcagtggaca
cccacacctttggcatactcatttcagggagataaaatataaggacaggggcacgcagacgccgggcccggctctctcat
tgggcaacgggatgctgccattcggcctggcagaggagcccagacgactctttcacggtaacgcagctttccgtttgcac
ttccctgcccattttgagcgtgtgggcgaagccatgccagaagatcagcagggacaggcagatcgtcaccatcagtggcc
gagtgtggaggcccagattgggcagaagcttcaaatgattggagaccagttccatcaagaacatgtacagcagcatcaca
gaaaccaaaggtggcggcgacagccattcctgtggcgcttggcctttgctttgtacaccttgatctttgaaagggatgct
gttggcgttcaagggagaggattggagcagaggtga
>gnl|bcl2dbcds|A0A8C4CCV8_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Denticeps clupeoides GN=PMAIP1 (length=153 residues).
agaaacctgcagcagcgaaaccaccaccgacagcagcccggcgtgctggagtgcgcggtccagctgcgtgaaatcgggga
ctttatcaactggaggtacaaggtgctggacctgctgctgaggacctactcgaagtcgaccgagatcaagtga
© 1998-2022Legal notice