Dataset for CDS classical BH3-containing proteins of organism Cyanistes caeruleus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C0UNY9_BCL2L11      nnnnnnnnnnnnnnnnnnnnnggagggag---------------------
A0A8C0U4T1_BMF-01       atggatcgccccagctacctggaagaggactattctagcctggatgggct
A0A8C0UP29_PMAIP1-      ----atcactaaagtagcgtgcggtggggatgtcat------------tt
                                                  *                       

A0A8C0UNY9_BCL2L11      -------------------------------------ggagggagggagg
A0A8C0U4T1_BMF-01       ggacgatgacgtgtttcactctgatgactttggacttgcaggtcagcctg
A0A8C0UP29_PMAIP1-      cggcggtaac----------------------gacgcgcggttccgcagg
                                                             *  *    *   *

A0A8C0UNY9_BCL2L11      gagggagggagg----------------atggagcctgcttca-------
A0A8C0U4T1_BMF-01       gtgagatgactgcaactggctttttcacacagaaccagtcctacagctgc
A0A8C0UP29_PMAIP1-      gcgcga-ggcggcggtgg-----------cggagtgcgccctggagct--
                        * * ** *   *                   **    *            

A0A8C0UNY9_BCL2L11      ------------------------ttcaccggcggcaggagaagcgctcg
A0A8C0U4T1_BMF-01       cttctggggagatttcaactattccccctcacacactgctgtggtcccgg
A0A8C0UP29_PMAIP1-      --------gag------------ccgcatcggcgacag--gtggcacctg
                                                  *  *     * *  *  *  *  *

A0A8C0UNY9_BCL2L11      gggcaggccttcccggt-----------ggcaatcccagtctgcagccga
A0A8C0U4T1_BMF-01       tatcag-gcatcctgagcagcaggacaaggcaactcaaacactcagccca
A0A8C0UP29_PMAIP1-      cggcagaggatcct----------------caacgtgatcgccaag----
                           ***    ***                 ***    *      **    

A0A8C0UNY9_BCL2L11      agaggtgc-agccggagatctggat-----cgcgcaggagctgcggcgca
A0A8C0U4T1_BMF-01       tcctcttccagtcaggatgttatgttgccttgtggagtcactgaagagcc
A0A8C0UP29_PMAIP1-      --ctgttctgccccgaaacctgggctgcc-cgcggagacggcg-agagga
                             * *    * *     *          * * **     *  * *  

A0A8C0UNY9_BCL2L11      tcggggacgagttc-----aatgcctcctattgtccacgca---------
A0A8C0U4T1_BMF-01       acggagactcttctatgggagtgctggttaccgtttacatgtccctccag
A0A8C0UP29_PMAIP1-      acgga------------agaggacc-------------------------
                         ***               *   *                          

A0A8C0UNY9_BCL2L11      ggggtttc------ttggatcagcag----gtggggaaccccc-------
A0A8C0U4T1_BMF-01       ctggttttgtg---ttggatcctcacctccaagaggaacctcaggaaggt
A0A8C0UP29_PMAIP1-      ttggttttgtggttttgg------------aagaaga-------------
                          *****       ****              *  **             

A0A8C0UNY9_BCL2L11      -------------------aggtggtgatcctgcgcctgctgcgttacat
A0A8C0U4T1_BMF-01       cagcgggaagcacgtgctgaggtgcagattgcacggaagttgcagtgcat
A0A8C0UP29_PMAIP1-      --------------------------------------------------
                                                                          

A0A8C0UNY9_BCL2L11      catccgcctcatctggaggctcca--------------------------
A0A8C0U4T1_BMF-01       tgccgaccagttccaccggctccacatacagaggcttttactcttctcca
A0A8C0UP29_PMAIP1-      -----------------ggctccacagacag-------------------
                                         *******                          

A0A8C0UNY9_BCL2L11      --------------------------------------------------
A0A8C0U4T1_BMF-01       ttctcctcaccaccagcaccttctcttctgtggaacatgcagccatcagt
A0A8C0UP29_PMAIP1-      --------------------------------------------------
                                                                          

A0A8C0UNY9_BCL2L11      ---------------------------gtga-------------------
A0A8C0U4T1_BMF-01       ggcttgtgtcagctcctcatcttggagataacaagcctggagtctgttct
A0A8C0UP29_PMAIP1-      ---------------------tgggagatga-------------------
                                                    * *                   

A0A8C0UNY9_BCL2L11      -------------------
A0A8C0U4T1_BMF-01       gacactccttgttgtctaa
A0A8C0UP29_PMAIP1-      -------------------
                                           

© 1998-2022Legal notice