Dataset for CDS classical BH3-containing proteins of organism Cyanistes caeruleus

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A8C0U4T1_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Cyanistes caeruleus GN=BMF (length=615 residues).
atggatcgccccagctacctggaagaggactattctagcctggatgggctggacgatgacgtgtttcactctgatgactt
tggacttgcaggtcagcctggtgagatgactgcaactggctttttcacacagaaccagtcctacagctgccttctgggga
gatttcaactattccccctcacacactgctgtggtcccggtatcaggcatcctgagcagcaggacaaggcaactcaaaca
ctcagcccatcctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccacggagactcttctatgggag
tgctggttaccgtttacatgtccctccagctggttttgtgttggatcctcacctccaagaggaacctcaggaaggtcagc
gggaagcacgtgctgaggtgcagattgcacggaagttgcagtgcattgccgaccagttccaccggctccacatacagagg
cttttactcttctccattctcctcaccaccagcaccttctcttctgtggaacatgcagccatcagtggcttgtgtcagct
cctcatcttggagataacaagcctggagtctgttctgacactccttgttgtctaa
>gnl|bcl2dbcds|A0A8C0UNY9_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Cyanistes caeruleus GN=BCL2L11 (length=306 residues).
nnnnnnnnnnnnnnnnnnnnnggagggagggagggagggagggagggagggaggatggagcctgcttcattcaccggcgg
caggagaagcgctcggggcaggccttcccggtggcaatcccagtctgcagccgaagaggtgcagccggagatctggatcg
cgcaggagctgcggcgcatcggggacgagttcaatgcctcctattgtccacgcaggggtttcttggatcagcaggtgggg
aacccccaggtggtgatcctgcgcctgctgcgttacatcatccgcctcatctggaggctccagtga
>gnl|bcl2dbcds|A0A8C0UP29_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Cyanistes caeruleus GN=PMAIP1 (length=264 residues).
atcactaaagtagcgtgcggtggggatgtcatttcggcggtaacgacgcgcggttccgcagggcgcgaggcggcggtggc
ggagtgcgccctggagctgagccgcatcggcgacaggtggcacctgcggcagaggatcctcaacgtgatcgccaagctgt
tctgccccgaaacctgggctgcccgcggagacggcgagaggaacggaagaggaccttggttttgtggttttggaagaaga
ggctccacagacagtgggagatga
© 1998-2022Legal notice