Dataset for CDS BAD of organism Coregonus sp balchen

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A6F9BAV3_BAD-01      --------------------------------------------------
A0A6F9CA11_BAD-02      atggctcagatgtttactatatcagacagcgaatcagagccctcagagga
A0A6F9CQZ0_BAD-02      ---------atgttcactatatcagactgcaaatcagaaccctcagag--
                                                                         

A0A6F9BAV3_BAD-01      ---atgagcaccagaccacgaccaggt------------gggcgtgtccg
A0A6F9CA11_BAD-02      tgtaggagaaacagaaactgaccaatcggcagccggaaaggggatgactg
A0A6F9CQZ0_BAD-02      -gtaggagaaacagaaaaggacaaatcagctgcaggacagggaatgactg
                          * *** * ****    *** *               ***  ** * *

A0A6F9BAV3_BAD-01      gc--tctact----------------------------------------
A0A6F9CA11_BAD-02      gcggcccactaggccacgccctcaccg-----------------------
A0A6F9CQZ0_BAD-02      gaggcccactaggccacaccctcactgtacctgagatgagactggcagga
                       *    * ***                                        

A0A6F9BAV3_BAD-01      ----------------------cagagtcccaggtgtgctcccaggttgg
A0A6F9CA11_BAD-02      ----------------------------ccca------------------
A0A6F9CQZ0_BAD-02      gagggtcggttgaggttgaattcagagtcccaggccttctctacgtcccg
                                                   ****                  

A0A6F9BAV3_BAD-01      caaaagggaagacacagagtttcaggatgtgatgactcctactgaggagg
A0A6F9CA11_BAD-02      ---------------ggagctccagggt----------------agtggg
A0A6F9CQZ0_BAD-02      tgggaagaggaatggggagctccaggga----------------aggggg
                                       *** * ****                  **  **

A0A6F9BAV3_BAD-01      gcgggggt----------------gatggggcttcattccgagggcgatc
A0A6F9CA11_BAD-02      ccaggggtggacggcgtgcccacagacggagcatctttccgggttcgctc
A0A6F9CQZ0_BAD-02      ccaggggtggacggcattcccacagatggagcaccttttcgggttcgctc
                        * *****                ** ** **  * ** ** *  ** **

A0A6F9BAV3_BAD-01      acagtctgctcctcctgcactgtgggctgcaaagaaatatggttgccagc
A0A6F9CA11_BAD-02      ccagtcggccccccctgccctctgggcggccaagaaatatggacggcagc
A0A6F9CQZ0_BAD-02      ccagtcggccccccctgccctctgggcggctaagagatacggacggcagc
                        ***** ** ** ***** ** ***** ** **** *** **  * ****

A0A6F9BAV3_BAD-01      tgaggaggatgagtgatgaatttgacacctggctcgacaaaggggagccc
A0A6F9CA11_BAD-02      tccgacgcatgagtgacgagtttgatacatggctggataaaggggagatg
A0A6F9CQZ0_BAD-02      tccgacgaatgagtgacgagtttgatacgtggctggataaaggggagatg
                       *  *  * ******** ** ***** ** ***** ** *********   

A0A6F9BAV3_BAD-01      aagagagggattagcccaggaggatgcaagcag-----aaagtctccc-g
A0A6F9CA11_BAD-02      aggcgggtgaagagtgcgggagcagccaaacagatgacaaagtcccccag
A0A6F9CQZ0_BAD-02      aagcagttgaagagtgttggagcagccaaacagatgacacagtcccccag
                       * *     **  **    **** *  *** ***     * **** *** *

A0A6F9BAV3_BAD-01      aggatggttctctttcctctggagtccaaag---gaggccgaaggcag--
A0A6F9CA11_BAD-02      ctggtgggcctacctgttcagccaccaagagacagagactgaacacacct
A0A6F9CQZ0_BAD-02      ctggtgggcctacctgttcagtcatcaggagacagagacagaacacagcc
                         * ***  **   *  ** *    *   **   *** * ***  **   

A0A6F9BAV3_BAD-01      -------------------------------ggagtga
A0A6F9CA11_BAD-02      ct------accatccc---accacgatcatctgagtag
A0A6F9CQZ0_BAD-02      ctaacctgaccgctcccgaaccacgataa---------
                                                             

© 1998-2020Legal notice