Dataset for CDS classical BH3-containing proteins of organism Colobus angolensis palliatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

9 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K5JY17_PMAIP1-      atg----------------------------------cctg---------
A0A2K5JY17_PMAIP1-      atg----------------------------------cctg---------
A0A2K5J4Q7_BIK-01       atgtctggagtaagacccatc-----tccagagacatcttg-----atgg
A0A2K5HZI5_BCL2L11      atggcaaagcaaccttctgatgtaagttctgag----tgtg-----accg
A0A2K5HZI5_BCL2L11      atggcaaagcaaccttctgatgtaagttctgag----tgtg-----accg
A0A2K5KGP2_BMF-02       atgg----------agcc-at-----ctcggtg----tgtg-----gagg
A0A2K5KGP2_BMF-01       atgg----------agcc-at-----ctcggtg----tgtg-----gagg
A0A2K5HKU7_BAD-01       atgt----------tccagat-----cccagag----tttgagcctagtg
A0A2K5HKU7_BAD-02       atgt----------tccagat-----cccagag----tttgagcctagtg
                        ***                                    **         

A0A2K5JY17_PMAIP1-      ----------ggaagaaggcgcgcaagaacgcgcaa--------------
A0A2K5JY17_PMAIP1-      ----------ggaagaaggcgcgcaagaacgcgcaa--------------
A0A2K5J4Q7_BIK-01       agaccctcctgtatgagcagctcctggaacccctaaccatggaggttctt
A0A2K5HZI5_BCL2L11      ag------aaggtagacaa----ttgcagcctgcgg--------------
A0A2K5HZI5_BCL2L11      ag------aaggtagacaa----ttgcagcctgcgg--------------
A0A2K5KGP2_BMF-02       ag------ctggaggatgacgtgttccagccggagg--------------
A0A2K5KGP2_BMF-01       ag------ctggaggatgacgtgttccagccggagg--------------
A0A2K5HKU7_BAD-01       ag------caggaaga-------ctccagctctgca--------------
A0A2K5HKU7_BAD-02       ag------caggaaga-------ctccagctctgca--------------
                                  *   **           * *                    

A0A2K5JY17_PMAIP1-      -------------------------ccgagcccagcgcgg----------
A0A2K5JY17_PMAIP1-      -------------------------ccgagcccagcgcgg----------
A0A2K5J4Q7_BIK-01       ggtgtgactgaccctgaagaggacctggacccta---tggaggacttcga
A0A2K5HZI5_BCL2L11      ---------------agaggcctccccagctcagacctggggcccctacc
A0A2K5HZI5_BCL2L11      ---------------agaggcctccccagctcagacctggggcccctacc
A0A2K5KGP2_BMF-02       ---------------acggggagccgggggcccaacccgggagctcgctc
A0A2K5KGP2_BMF-01       ---------------acggggagccgggggcccaacccgggagctcgctc
A0A2K5HKU7_BAD-01       ---------------gagaggggcctgggccccagcccgg----------
A0A2K5HKU7_BAD-02       ---------------gagaggggcctgggccccagcccgg----------
                                                       *      **          

A0A2K5JY17_PMAIP1-      ---------------gctcaggcag-------------------------
A0A2K5JY17_PMAIP1-      ---------------gctcaggcaggtactga------------------
A0A2K5J4Q7_BIK-01       tcctttggagtgtatggaggacagtgacatg-------------------
A0A2K5HZI5_BCL2L11      tccctacagacagaaccacaaggtaatcccgaaggcaatcacggaggtga
A0A2K5HZI5_BCL2L11      tccctacagacagaaccacaaggtaatcccgaaggcaatcacggaggtga
A0A2K5KGP2_BMF-02       tctgccgatctgtttgcccagagcttacttga------------------
A0A2K5KGP2_BMF-01       tctgccgatctgtttgcccagagcttacttga------------------
A0A2K5HKU7_BAD-01       ------------------caggg-------ga------------------
A0A2K5HKU7_BAD-02       ------------------caggg-------ga------------------
                                                                          

A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      -----------cccgctggggccagcgaagacccaggctgggcggggtcg
A0A2K5J4Q7_BIK-01       ---------ttggccctgcggctggcctgcatcggggatgagatggacgt
A0A2K5HZI5_BCL2L11      aggggacagctgcccccacggcagccct----------cag--ggcccgc
A0A2K5HZI5_BCL2L11      aggggacagctgcccccacggcagccct----------cag--ggcccgc
A0A2K5KGP2_BMF-02       ---------ctgccccctcagccgactt----------cagctcttccct
A0A2K5KGP2_BMF-01       ---------ctgccccctcagccgactt----------cagctcttccct
A0A2K5HKU7_BAD-01       ---------caggccct----cagactc----------cggcaagc----
A0A2K5HKU7_BAD-02       ---------caggccct----cagactc----------cggcaagc----
                                                                          

A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      gggccggggcaaaaagctcctctcctcc---------ccacttgccctt-
A0A2K5J4Q7_BIK-01       gagcctcagggccccgcgcctggc-------------ccagctctctga-
A0A2K5HZI5_BCL2L11      tggccccaccggccagccctggcccttttg----ctaccagatccccgct
A0A2K5HZI5_BCL2L11      tggccccaccggccagccctggcccttttg----ctaccagatccccgct
A0A2K5KGP2_BMF-02       ctcacccactgctgtggccctggccttc---gacccaccag---ccagg-
A0A2K5KGP2_BMF-01       ctcacccactgctgtggccctggccttc---gacccaccag---ccagg-
A0A2K5HKU7_BAD-01       ----atcatcgccaggccccaggcctcctgtgggacgccagtcaccagc-
A0A2K5HKU7_BAD-02       ----atcatcgccaggccccaggcctcctgtgggacgccagtcaccagc-
                                                                          

A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      ---------------------ccgcggggccacgaggaacaagtgcaagt
A0A2K5J4Q7_BIK-01       ---------ggtggccatgcacagcctgggtctggctttcatctacgacc
A0A2K5HZI5_BCL2L11      tttcatctttatgagaagatcctccctg-----------ctgtctcgatc
A0A2K5HZI5_BCL2L11      tttcatctttatgagaagatcctccctg-----------ctgtctcgatc
A0A2K5KGP2_BMF-02       ----------aagacaagg--ctacccagaccctcggcccagcctccccc
A0A2K5KGP2_BMF-01       ----------aagacaagg--ctacccagaccctcggcccagcctccccc
A0A2K5HKU7_BAD-01       ----------aggagcagg--caaccag-----------cagcagccatc
A0A2K5HKU7_BAD-02       ----------aggagcagg--caaccag-----------cagcagccatc
                                                                          

A0A2K5JY17_PMAIP1-      agctcgaa---gtcgagtgtgctactc-------------aactcaggag
A0A2K5JY17_PMAIP1-      agctcgaa---gtcgagtgtgctactc-------------aactcaggag
A0A2K5J4Q7_BIK-01       agaccgacgacatcagggatgtt-------------------cttagaag
A0A2K5HZI5_BCL2L11      ctccagtg-------ggtatttctcttttga-------------------
A0A2K5HZI5_BCL2L11      ctccagtg-------ggtatttctcttttga-------------------
A0A2K5KGP2_BMF-02       agccaagg------tgtcatgctgcct-----tgtggggtaactgaggaa
A0A2K5KGP2_BMF-01       agccaagg------tgtcatgctgcct-----tgtggggtaactgaggaa
A0A2K5HKU7_BAD-01       a-------------------------------------------------
A0A2K5HKU7_BAD-02       atggagggagagcttggtattctccttctgaatctgaggactctgaaaat
                                                                          

A0A2K5JY17_PMAIP1-      atttggagacaaactgaac-------------------------------
A0A2K5JY17_PMAIP1-      atttggagacaaactgaac-------------------------------
A0A2K5J4Q7_BIK-01       tttcatggacggcttcacc-------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2K5KGP2_BMF-02       ccccagcgactgttttatggcaatgctggctaccggcttcctctccctgc
A0A2K5KGP2_BMF-01       ccccagcgactgttttatg-------------------------------
A0A2K5HKU7_BAD-01       --------------------------------------------------
A0A2K5HKU7_BAD-02       cccagtgcaaggatgctcacggaagcatcagcagggatgtctgccccagc
                                                                          

A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5J4Q7_BIK-01       ----------------------------acccttaaggagaacataatga
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2K5KGP2_BMF-02       cagtttcccggcagtcttgcccatcggggagcagccccccgaagggcagt
A0A2K5KGP2_BMF-01       --------------------------------------------------
A0A2K5HKU7_BAD-01       --------------------------------------tggaggcgctgg
A0A2K5HKU7_BAD-02       cactgactcagaagcccaacacgcagagaatgtaaagctggaggcgctgg
                                                                          

A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5J4Q7_BIK-01       ggttctggagatcc------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2K5KGP2_BMF-02       ggcaacatcgagcagaggtacagattgcccgaaagcttcagtgcattgca
A0A2K5KGP2_BMF-01       --------------------------------------------------
A0A2K5HKU7_BAD-01       ggctgtggagacccggagt-------------------------------
A0A2K5HKU7_BAD-02       ggctgtggagacccggagt-------------------------------
                                                                          

A0A2K5JY17_PMAIP1-      ------------------------------ttccggcagaaacttctgaa
A0A2K5JY17_PMAIP1-      ------------------------------ttccggcagaaacttctgaa
A0A2K5J4Q7_BIK-01       ------------------------------------ccgaatcccgggtc
A0A2K5HZI5_BCL2L11      ------------------------------cacagacaggagcccagcac
A0A2K5HZI5_BCL2L11      ------------------------------cacagacaggagcccagcac
A0A2K5KGP2_BMF-02       gaccagttccaccggcttcatgtgcagcaacac---cagcagaaccgaaa
A0A2K5KGP2_BMF-01       ------------------------------cac---cagcagaaccgaaa
A0A2K5HKU7_BAD-01       ------------------------------cgc---ca-cagctcccacc
A0A2K5HKU7_BAD-02       ------------------------------cgc---ca-cagctcccacc
                                                            *   *         

A0A2K5JY17_PMAIP1-      tc-------------------------tgatagccaaac-----------
A0A2K5JY17_PMAIP1-      tc-------------------------tgatagccaaac-----------
A0A2K5J4Q7_BIK-01       ccgggtg------------------tcccgcgaacaggtgctgctggcgc
A0A2K5HZI5_BCL2L11      ccatgag--------------------ttgtgacaaatcaacacaaaccc
A0A2K5HZI5_BCL2L11      ccatgag--------------------ttgtgacaaatcaacacaaaccc
A0A2K5KGP2_BMF-02       tcgcgtg--------------------tggtggcagatc----ct--cct
A0A2K5KGP2_BMF-01       tcgcgtg--------------------tggtggcagatc----ct--cct
A0A2K5HKU7_BAD-01       ccgcggggacggaggaggacgaagggatggaggaggagc----ccagccc
A0A2K5HKU7_BAD-02       ccgcggggacggaggaggacgaagggatggaggaggagc----ccagccc
                         *                                                

A0A2K5JY17_PMAIP1-      -------------------tcttctgctcaggaacctga-----------
A0A2K5JY17_PMAIP1-      -------------------tcttctgctcaggaacctgactgcaacaaaa
A0A2K5J4Q7_BIK-01       t------------------gctgctgctgctggcactg--ctgctggcgc
A0A2K5HZI5_BCL2L11      c---------------aagtcctccttgccaggcctt---caaccactat
A0A2K5HZI5_BCL2L11      c---------------aagtcctccttgccaggcctt---caaccactat
A0A2K5KGP2_BMF-02       ctt----------------cctgcacaaccttgctttgaatggagaagag
A0A2K5KGP2_BMF-01       ctt----------------cctgcacaaccttgctttgaatggagaagag
A0A2K5HKU7_BAD-01       ctttcggggccgctcgcgctccgcgccccctaacctc---tgggcagcac
A0A2K5HKU7_BAD-02       ctttcggggccgctcgcgctccgcgccccctaacctc---tgggcagcac
                                            *  *                          

A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      acttgcatgaggggac----------tccaaaagagaatttttctcagga
A0A2K5J4Q7_BIK-01       tgctcagcgggggcctgcacctgctgctcaagtga---------------
A0A2K5HZI5_BCL2L11      ctcagtgcaatgggtgtt--------tttgaataa---------------
A0A2K5HZI5_BCL2L11      ctcagtgcaatggctaac--------tgggactag---------------
A0A2K5KGP2_BMF-02       aacaggaacggggcgggc--------cccaggtga---------------
A0A2K5KGP2_BMF-01       aacaggaacggggcgggc--------cccaggtgaggctgggc-------
A0A2K5HKU7_BAD-01       agcgatatggccgcgagc--------tccggaggatgagtgacgagtttg
A0A2K5HKU7_BAD-02       agcgatatggccgcgagc--------tccggaggatga------------
                                                                          

A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      ggtgcacatttcatcaatttgaagcaagattgcattgtaat---------
A0A2K5J4Q7_BIK-01       --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2K5KGP2_BMF-02       --------------------------------------------------
A0A2K5KGP2_BMF-01       tgccctcttcacatggggcaccaggaacaccgtcaggaaggacatcgggc
A0A2K5HKU7_BAD-01       tggactcttttaagggacttcctcgcccgaagagcgcgggcacagcgacg
A0A2K5HKU7_BAD-02       --------------------------------------------------
                                                                          

A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5JY17_PMAIP1-      --------------------------------------------------
A0A2K5J4Q7_BIK-01       --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2K5HZI5_BCL2L11      --------------------------------------------------
A0A2K5KGP2_BMF-02       --------------------------------------------------
A0A2K5KGP2_BMF-01       aggactgacactgtgtcttgtgaagttgtttttttgttgttattttgcgt
A0A2K5HKU7_BAD-01       cagatgcggcaaagctccagctggacgcgagtcttccagtcctggtggga
A0A2K5HKU7_BAD-02       --------------------------------------------------
                                                                          

A0A2K5JY17_PMAIP1-      ----------------------------------------
A0A2K5JY17_PMAIP1-      ----------------------------------------
A0A2K5J4Q7_BIK-01       ----------------------------------------
A0A2K5HZI5_BCL2L11      ----------------------------------------
A0A2K5HZI5_BCL2L11      ----------------------------------------
A0A2K5KGP2_BMF-02       ----------------------------------------
A0A2K5KGP2_BMF-01       tttaa-----------------------------------
A0A2K5HKU7_BAD-01       tcggaacttgggcaggggaagctccgccccctcccagtga
A0A2K5HKU7_BAD-02       ----------------------------------------
                                                                

© 1998-2020Legal notice