Dataset for CDS classical BH3-containing proteins of organism Chelonoidis abingdonii

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C0IJG1_BAD-01       atgt----------------ttcgcatccaggagttcccggacgaggtct
A0A8C0GP31_PMAIP1-      atgc----------------------------------------------
A0A8C0GH19_BMF-01       atgg-------atccccccagctacct---------------ggaagacg
A0A8C0QRC8_BCL2L11      atggcaaagcaaccttctgatctaaattcagagtgcaacagagaaggtgg
                        ***                                               

A0A8C0IJG1_BAD-01       ----tcccggggcgagggaaggaggcgcctgctcc---------------
A0A8C0GP31_PMAIP1-      --------------cgggaaaga---------------------------
A0A8C0GH19_BMF-01       actattccagc---ctggacgggctggacgatgac-gtgtttca------
A0A8C0QRC8_BCL2L11      acagtttcagtcaactgaaaggccaagtcaacctcagcatcttagacctg
                                        * *  *                            

A0A8C0IJG1_BAD-01       ----ccccgagtc--------------------------------gcagc
A0A8C0GP31_PMAIP1-      ----ccctgc-----------------------------------gcaag
A0A8C0GH19_BMF-01       ----ctctgactttggactcaca------------ggtcagcctggtga-
A0A8C0QRC8_BCL2L11      gggcccctacctctatacaaacacagtatcaaggtaatcattcaggtgag
                            * *                                      *    

A0A8C0IJG1_BAD-01       ggggac------------acacgcccggctccaagcagccagacaccccc
A0A8C0GP31_PMAIP1-      ggtg----------------------------------------------
A0A8C0GH19_BMF-01       gatgactcctcctggcattttcacacagaaccaatcctacagctgtctcc
A0A8C0QRC8_BCL2L11      ggggacttcgcccagca-gccctcagggagctcttcgcccagcagccctc
                        *  *                                              

A0A8C0IJG1_BAD-01       atagctgaggtgcgaaaccggatag---------------------ggtc
A0A8C0GP31_PMAIP1-      --------------------------------------------------
A0A8C0GH19_BMF-01       tggggaggttt--------caactgttccccctcacacactgctgtggtc
A0A8C0QRC8_BCL2L11      agggaccatttgcaccacccagtagccccagtccatttgctaccagatcc
                                                                          

A0A8C0IJG1_BAD-01       agacactccatctctggagccagaagtgcaggatgagccaggt-------
A0A8C0GP31_PMAIP1-      --------------------------------------------------
A0A8C0GH19_BMF-01       caggtatcaggcatgctgagcagcaggacaaggcaacccaaacactc---
A0A8C0QRC8_BCL2L11      ccacttttcatctttgtaagaagatcctcactgctgtctagatcctccag
                                                                          

A0A8C0IJG1_BAD-01       ---------------------------------------------ggggc
A0A8C0GP31_PMAIP1-      -------------------------------------------------c
A0A8C0GH19_BMF-01       --agtccatcctcttccactcag---gatgtcatgttgccatgtggagtc
A0A8C0QRC8_BCL2L11      tgggtatttctctttcgacacagacaggagtcctgcgcctat---gagtt
                                                                          

A0A8C0IJG1_BAD-01       attccgggcacgctcacgctc-----------------------------
A0A8C0GP31_PMAIP1-      gcagcagaacccc-------------------------------------
A0A8C0GH19_BMF-01       actgaagagccccagagactcttctatgggaatgctgggtaccgtttaca
A0A8C0QRC8_BCL2L11      gcgacaagtccacgcagactc---------------------------ca
                                  * *                                     

A0A8C0IJG1_BAD-01       agcaccccccat------------------------------------cc
A0A8C0GP31_PMAIP1-      ------------------------------------------------gc
A0A8C0GH19_BMF-01       tgtccctccagttggctttgcattgaatccgcacctccaagagga---gc
A0A8C0QRC8_BCL2L11      agtcccccttgtcaa----gcctttaatcatta--tctaagtgcaatggc
                                                                         *

A0A8C0IJG1_BAD-01       tttggg------------------------------------ctgctatg
A0A8C0GP31_PMAIP1-      tcccg---------------cagcacaggaag----------ctgtgacc
A0A8C0GH19_BMF-01       ctcaggaagg---------tca--acgggaagcacgtg----ctgaggtt
A0A8C0QRC8_BCL2L11      ttccaggtgggagtcttcctcaatacgtgaag-acatgcagccggaaata
                                                                  * *     

A0A8C0IJG1_BAD-01       cgttatgggcgggagctgcgcaggatgagtgacgagtttgatgtggcact
A0A8C0GP31_PMAIP1-      cagtgctctttgcaactacgcaaaataggagatatatgcaa---------
A0A8C0GH19_BMF-01       cagattgcacggaagttacagtgcattgcagaccagttcca---------
A0A8C0QRC8_BCL2L11      tggattgcacaggaactgcggcgtattggagatgagtttaa---------
                                   * *  * *     **    **    *   *         

A0A8C0IJG1_BAD-01       gcaggtgctgccacgccccaagagtgcaggcacgacatcccagctgcacc
A0A8C0GP31_PMAIP1-      --------------------------c----------------ttgcagc
A0A8C0GH19_BMF-01       --------------------------caggctccacat-acagaggcatc
A0A8C0QRC8_BCL2L11      --------------------------t--gcttcctat------tgccca
                                                                     **   

A0A8C0IJG1_BAD-01       aggggaacagctggaaagagaccctccagg--cctggttggggcacagac
A0A8C0GP31_PMAIP1-      agaagatt------------------------cttaatgttattacaaaa
A0A8C0GH19_BMF-01       agcagaacagaaatcaagtgtggtggcagatccttctcttcatacataac
A0A8C0QRC8_BCL2L11      agaagggtaa----------------------ctttattttat------t
                        **  *                           * *               

A0A8C0IJG1_BAD-01       ccgcccgtgat----gccctccccaggagctcc---------aagtga
A0A8C0GP31_PMAIP1-      ctgttct-------------gcccaggaac--------------gtga
A0A8C0GH19_BMF-01       ttggccttaaatgtggaggcgaacaggaaccacgtaggtcagaggtga
A0A8C0QRC8_BCL2L11      ttattttttaa-------------------------------------
                                                                        

© 1998-2022Legal notice