Dataset for CDS classical BH3-containing proteins of organism Chelonoidis abingdonii

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|A0A8C0GH19_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Chelonoidis abingdonii GN=BMF (length=579 residues).
atggatccccccagctacctggaagacgactattccagcctggacgggctggacgatgacgtgtttcactctgactttgg
actcacaggtcagcctggtgagatgactcctcctggcattttcacacagaaccaatcctacagctgtctcctggggaggt
ttcaactgttccccctcacacactgctgtggtccaggtatcaggcatgctgagcagcaggacaaggcaacccaaacactc
agtccatcctcttccactcaggatgtcatgttgccatgtggagtcactgaagagccccagagactcttctatgggaatgc
tgggtaccgtttacatgtccctccagttggctttgcattgaatccgcacctccaagaggagcctcaggaaggtcaacggg
aagcacgtgctgaggttcagattgcacggaagttacagtgcattgcagaccagttccacaggctccacatacagaggcat
cagcagaacagaaatcaagtgtggtggcagatccttctcttcatacataacttggccttaaatgtggaggcgaacaggaa
ccacgtaggtcagaggtga
>gnl|bcl2dbcds|A0A8C0GP31_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Chelonoidis abingdonii GN=PMAIP1 (length=165 residues).
atgccgggaaagaccctgcgcaagggtgcgcagcagaaccccgctcccgcagcacaggaagctgtgacccagtgctcttt
gcaactacgcaaaataggagatatatgcaacttgcagcagaagattcttaatgttattacaaaactgttctgcccaggaa
cgtga
>gnl|bcl2dbcds|A0A8C0IJG1_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Chelonoidis abingdonii GN=BAD (length=426 residues).
atgtttcgcatccaggagttcccggacgaggtcttcccggggcgagggaaggaggcgcctgctccccccgagtcgcagcg
gggacacacgcccggctccaagcagccagacacccccatagctgaggtgcgaaaccggatagggtcagacactccatctc
tggagccagaagtgcaggatgagccaggtggggcattccgggcacgctcacgctcagcaccccccatcctttgggctgct
atgcgttatgggcgggagctgcgcaggatgagtgacgagtttgatgtggcactgcaggtgctgccacgccccaagagtgc
aggcacgacatcccagctgcaccaggggaacagctggaaagagaccctccaggcctggttggggcacagacccgcccgtg
atgccctccccaggagctccaagtga
>gnl|bcl2dbcds|A0A8C0QRC8_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Chelonoidis abingdonii GN=BCL2L11 (length=552 residues).
atggcaaagcaaccttctgatctaaattcagagtgcaacagagaaggtggacagtttcagtcaactgaaaggccaagtca
acctcagcatcttagacctggggcccctacctctatacaaacacagtatcaaggtaatcattcaggtgagggggacttcg
cccagcagccctcagggagctcttcgcccagcagccctcagggaccatttgcaccacccagtagccccagtccatttgct
accagatccccacttttcatctttgtaagaagatcctcactgctgtctagatcctccagtgggtatttctctttcgacac
agacaggagtcctgcgcctatgagttgcgacaagtccacgcagactccaagtcccccttgtcaagcctttaatcattatc
taagtgcaatggcttccaggtgggagtcttcctcaatacgtgaagacatgcagccggaaatatggattgcacaggaactg
cggcgtattggagatgagtttaatgcttcctattgcccaagaagggtaactttattttattttattttttaa
© 1998-2022Legal notice