Dataset for CDS BCL2L11 of organism Capra hircus

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C2P0X3_BCL2L11      --------------------------------------------------
A0A8C2P0X3_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A8C2P0X3_BCL2L11      --------------------------------------------------
A0A8C2P0X3_BCL2L11      atgggggcttcggctggggagagggtggcctttagggtgcccaccccagc
A0A8C2P0X3_BCL2L11      atgggggcttcggctggggagagggtggcctttagggtgcccaccccagc
                                                                          

A0A8C2P0X3_BCL2L11      --------------------------------------------------
A0A8C2P0X3_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A8C2P0X3_BCL2L11      --------------------------------------------------
A0A8C2P0X3_BCL2L11      gggcctgcactggggtcggcggccggggctggagtctggggccggctctg
A0A8C2P0X3_BCL2L11      gggcctgcactggggtcggcggccggggctggagtctggggccggctctg
                                                                          

A0A8C2P0X3_BCL2L11      --------------------------------------------------
A0A8C2P0X3_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A8C2P0X3_BCL2L11      --------------------------------------------------
A0A8C2P0X3_BCL2L11      cgggttctgttttgtctccaggtgaccggctctcgggggcggcgggagct
A0A8C2P0X3_BCL2L11      cgggttctgttttgtctccaggtgaccggctctcgggggcggcgggagct
                                                                          

A0A8C2P0X3_BCL2L11      --------------------------------------------------
A0A8C2P0X3_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A8C2P0X3_BCL2L11      --------------------------------------------------
A0A8C2P0X3_BCL2L11      gcagaggcgggcgcggcgccaggactgacggaggggaggggcaggtttgg
A0A8C2P0X3_BCL2L11      gcagaggcgggcgcggcgccaggactgacggaggggaggggcaggtttgg
                                                                          

A0A8C2P0X3_BCL2L11      --------------------------------------------------
A0A8C2P0X3_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A8C2P0X3_BCL2L11      --------------------------------------------------
A0A8C2P0X3_BCL2L11      ctgggcagccccggtcccagaggccccggaaacctccgccgccgctcccg
A0A8C2P0X3_BCL2L11      ctgggcagccccggtcccagaggccccggaaacctccgccgccgctcccg
                                                                          

A0A8C2P0X3_BCL2L11      --------------------------------------------------
A0A8C2P0X3_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A8C2P0X3_BCL2L11      --------------------------------------------------
A0A8C2P0X3_BCL2L11      ccgcagtcagggcccgagccgcgttcggcggcgagtttgtcaacaatcgc
A0A8C2P0X3_BCL2L11      ccgcagtcagggcccgagccgcgttcggcggcgagtttgtcaacaatcgc
                                                                          

A0A8C2P0X3_BCL2L11      --------------------------------------------------
A0A8C2P0X3_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A8C2P0X3_BCL2L11      --------------------------------------------------
A0A8C2P0X3_BCL2L11      ctcgccttcggcggcctgttggcaggcgccgcccccgccgccgccaccga
A0A8C2P0X3_BCL2L11      ctcgccttcggcggcctgttggcaggcgccgcccccgccgccgccaccga
                                                                          

A0A8C2P0X3_BCL2L11      --------------------------------------------------
A0A8C2P0X3_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A8C2P0X3_BCL2L11      --------------------------------------------------
A0A8C2P0X3_BCL2L11      ttggctgcggctccgagnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
A0A8C2P0X3_BCL2L11      ttggctgcggctccgagnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
                                                                          

A0A8C2P0X3_BCL2L11      --------------------------------------------------
A0A8C2P0X3_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A8C2P0X3_BCL2L11      --------------------------------------------------
A0A8C2P0X3_BCL2L11      nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
A0A8C2P0X3_BCL2L11      nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
                                                                          

A0A8C2P0X3_BCL2L11      --------------------------------------------------
A0A8C2P0X3_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A8C2P0X3_BCL2L11      --------------------------------------------------
A0A8C2P0X3_BCL2L11      nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
A0A8C2P0X3_BCL2L11      nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
                                                                          

A0A8C2P0X3_BCL2L11      --------------------------------------------------
A0A8C2P0X3_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A8C2P0X3_BCL2L11      --------------------------------------------------
A0A8C2P0X3_BCL2L11      nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
A0A8C2P0X3_BCL2L11      nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
                                                                          

A0A8C2P0X3_BCL2L11      --------------------------------------------------
A0A8C2P0X3_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A8C2P0X3_BCL2L11      --------------------------------------------------
A0A8C2P0X3_BCL2L11      nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
A0A8C2P0X3_BCL2L11      nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
                                                                          

A0A8C2P0X3_BCL2L11      --------------------------------------------------
A0A8C2P0X3_BCL2L11      ---------atgtctgaccctaattcacgaactgagaaacgcaaggctcg
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A8C2P0X3_BCL2L11      --------------------------------------------------
A0A8C2P0X3_BCL2L11      nnnnnngggagctcagagcgcgagtctcgggctttgtttcccgcgccgcc
A0A8C2P0X3_BCL2L11      nnnnnngggagctcagagcgcgagtctcgggctttgtttcccgcgccgcc
                                                                          

A0A8C2P0X3_BCL2L11      ----------------------------------------atggcaaagc
A0A8C2P0X3_BCL2L11      ttgtgaaggatttatggaacagcgacgaaaaaaagaccaaatggcaaagc
A0A452FCR6_BCL2L11      ----------------------------------------atggcaaagc
A0A452FCR6_BCL2L11      ----------------------------------------atggcaaagc
A0A8C2P0X3_BCL2L11      ----------------------------------------atggcaaagc
A0A8C2P0X3_BCL2L11      ttcgtgtggactgtcggggggttccagaaaaaaagaccaaatggcaaagc
A0A8C2P0X3_BCL2L11      ttcgtgtggactgtcggggggttccagaaaaaaagaccaaatggcaaagc
                                                                **********

A0A8C2P0X3_BCL2L11      aaccttccgatgtaagttctgagtgtgacagagaaggtggacaattgcag
A0A8C2P0X3_BCL2L11      aaccttccgatgtaagttctgagtgtgacagagaaggtggacaattgcag
A0A452FCR6_BCL2L11      aaccttccgatgtaagttctgagtgtgacagagaaggtggacaattgcag
A0A452FCR6_BCL2L11      aaccttccgatgtaagttctgagtgtgacagagaaggtggacaattgcag
A0A8C2P0X3_BCL2L11      aaccttccgatgtaagttctgagtgtgacagagaaggtggacaattgcag
A0A8C2P0X3_BCL2L11      aaccttccgatgtaagttctgagtgtgacagagaaggtggacaattgcag
A0A8C2P0X3_BCL2L11      aaccttccgatgtaagttctgagtgtgacagagaaggtggacaattgcag
                        **************************************************

A0A8C2P0X3_BCL2L11      cctgccgagaggcctcctcagctcagaccaggggcccccacctctttaca
A0A8C2P0X3_BCL2L11      cctgccgagaggcctcctcagctcagaccaggggcccccacctctttaca
A0A452FCR6_BCL2L11      cctgccgagaggcctcctcagctcagaccaggggcccccacctctttaca
A0A452FCR6_BCL2L11      cctgccgagaggcctcctcagctcagaccaggggcccccacctctttaca
A0A8C2P0X3_BCL2L11      cctgccgagaggcctcctcagctcagaccaggggcccccacctctttaca
A0A8C2P0X3_BCL2L11      cctgccgagaggcctcctcagctcagaccaggggcccccacctctttaca
A0A8C2P0X3_BCL2L11      cctgccgagaggcctcctcagctcagaccaggggcccccacctctttaca
                        **************************************************

A0A8C2P0X3_BCL2L11      gacagagcggcaaggtaatcctgaaggagaaggggaccgctgcccccaag
A0A8C2P0X3_BCL2L11      gacagagcggcaaggtaatcctgaaggagaaggggaccgctgcccccaag
A0A452FCR6_BCL2L11      gacagagcggcaaggtaatcctgaaggagaaggggaccgctgcccccaag
A0A452FCR6_BCL2L11      gacagagcggca--------------------------------------
A0A8C2P0X3_BCL2L11      gacagagcggca--------------------------------------
A0A8C2P0X3_BCL2L11      gacagagcggca--------------------------------------
A0A8C2P0X3_BCL2L11      gacagagcggca--------------------------------------
                        ************                                      

A0A8C2P0X3_BCL2L11      gcagcccgcagggcccgctggccccaccagccagccccggccctttcgct
A0A8C2P0X3_BCL2L11      gcagcccgcagggcccgctggccccaccagccagccccggccctttcgct
A0A452FCR6_BCL2L11      gcagcccgcagggcccgctggccccaccggccagccccggccctttcgct
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A8C2P0X3_BCL2L11      --------------------------------------------------
A0A8C2P0X3_BCL2L11      --------------------------------------------------
A0A8C2P0X3_BCL2L11      --------------------------------------------------
                                                                          

A0A8C2P0X3_BCL2L11      accagatccccgctcttcatcttcgtgagaagatcctccttgctgtctcg
A0A8C2P0X3_BCL2L11      accagatccccgctcttcatcttcgtgagaagatcctccttgctgtctcg
A0A452FCR6_BCL2L11      accagatccccgctcttcatcttcgtgagaagatcctccttgctgtctcg
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A8C2P0X3_BCL2L11      --------------------------------------------------
A0A8C2P0X3_BCL2L11      --------------------------------------------------
A0A8C2P0X3_BCL2L11      --------------------------------------------------
                                                                          

A0A8C2P0X3_BCL2L11      gtcctccagcgggtatttctcttttgacacagacaggagcccggcaccca
A0A8C2P0X3_BCL2L11      gtcctccagcgggtatttctcttttgacacagacaggagcccggcaccca
A0A452FCR6_BCL2L11      gtcctccagcgggtatttctcttttgacacagacaggagcccggcaccca
A0A452FCR6_BCL2L11      ------------------------------agacaggagcccggcaccca
A0A8C2P0X3_BCL2L11      ------------------------------agacaggagcccggcaccca
A0A8C2P0X3_BCL2L11      ------------------------------agacaggagcccggcaccca
A0A8C2P0X3_BCL2L11      ------------------------------a-------------------
                                                      *                   

A0A8C2P0X3_BCL2L11      tgagttgtgacaaatccacacagaccccaagccctccttgccaggccttc
A0A8C2P0X3_BCL2L11      tgagttgtgacaaatccacacagaccccaagccctccttgccaggccttc
A0A452FCR6_BCL2L11      tgagttgtgacaaatccacacagaccccaagccctccttgccaggccttc
A0A452FCR6_BCL2L11      tgagttgtgacaaatccacacagaccccaagccctccttgccaggccttc
A0A8C2P0X3_BCL2L11      tgagttgtgacaaatccacacagaccccaagccctccttgccaggccttc
A0A8C2P0X3_BCL2L11      tgagttgtgacaaatccacacagaccccaagccctccttgccaggccttc
A0A8C2P0X3_BCL2L11      --------------------------------------------------
                                                                          

A0A8C2P0X3_BCL2L11      aaccattatctcagtgcaatggcttccatgaggcagtctcaggctgtacc
A0A8C2P0X3_BCL2L11      aaccattatctcagtgcaatggcttccatgaggcagtctcaggctgtacc
A0A452FCR6_BCL2L11      aaccattatctcagtgcaatggcttccatgaggcagtctcaggctgtacc
A0A452FCR6_BCL2L11      aaccattatctcagtgcaatggcttccatgaggcagtctcaggctgtacc
A0A8C2P0X3_BCL2L11      aaccattatctcagtgcaatggcttccatgaggcagtctcaggctgtacc
A0A8C2P0X3_BCL2L11      aaccattatctcagtgcaatggcttccatgaggcagtctcaggctgtacc
A0A8C2P0X3_BCL2L11      ---------------------gcttccatgaggcagtctcaggctgtacc
                                             *****************************

A0A8C2P0X3_BCL2L11      tgcagatacacgcccagagatatggattgcccaagagctacggcgtatcg
A0A8C2P0X3_BCL2L11      tgcagatacacgcccagagatatggattgcccaagagctacggcgtatcg
A0A452FCR6_BCL2L11      tgcagatacacgcccagagatatggattgcccaagagctacggcgtatcg
A0A452FCR6_BCL2L11      tgcagatacacgcccagagatatggattgcccaagagctacggcgtatcg
A0A8C2P0X3_BCL2L11      tgcagatacacgcccagagatatggattgcccaagagctacggcgtatcg
A0A8C2P0X3_BCL2L11      tgcagatacacgcccagagatatggattgcccaagagctacggcgtatcg
A0A8C2P0X3_BCL2L11      tgcagatacacgcccagagatatggattgcccaagagctacggcgtatcg
                        **************************************************

A0A8C2P0X3_BCL2L11      gagacgagtttaatgcgtattacccaagaagggtcttcgtgcgtcaccag
A0A8C2P0X3_BCL2L11      gagacgagtttaatgcgtattacccaagaagggtcttcgtgcgtcaccag
A0A452FCR6_BCL2L11      gagacgagtttaatgcgtattacccaagaagggtcttcgtgcgtcaccag
A0A452FCR6_BCL2L11      gagacgagtttaatgcgtattacccaagaagggtcttcgtgcgtcaccag
A0A8C2P0X3_BCL2L11      gagacgagtttaatgcgtattacccaagaaggtt----------------
A0A8C2P0X3_BCL2L11      gagacgagtttaatgcgtattacccaagaagggt----------------
A0A8C2P0X3_BCL2L11      gagacgagtttaatgcgtattacccaagaagggt----------------
                        ******************************** *                

A0A8C2P0X3_BCL2L11      gcgattgagggccacccacaaatggtcctnnnnnnngtcttgcgctacct
A0A8C2P0X3_BCL2L11      gcgattgagggccacccacaaatggtcctnnnnnnngtcttgcgctacct
A0A452FCR6_BCL2L11      gcgattgagggccacccacaaatggtcctcctgcgcgtcttgcgctacct
A0A452FCR6_BCL2L11      gcgattgagggccacccacaaatggtcctcctgcgcgtcttgcgctacct
A0A8C2P0X3_BCL2L11      -----------------a--------------------------------
A0A8C2P0X3_BCL2L11      -----------------aaatgatgttttctttacctccttttttgattc
A0A8C2P0X3_BCL2L11      -----------------aaatgatgttttctttacctccttttttgattc
                                         *                                

A0A8C2P0X3_BCL2L11      ggtgcgtctggtgtggaggatgcagtga-------
A0A8C2P0X3_BCL2L11      ggtgcgtctggtgtggaggatgcagtga-------
A0A452FCR6_BCL2L11      ggtgcgtctggtgtggaggatgcagtga-------
A0A452FCR6_BCL2L11      ggtgcgtctggtgtggaggatgcagtga-------
A0A8C2P0X3_BCL2L11      ------------------ga-gcg-------ctag
A0A8C2P0X3_BCL2L11      tgtgcttattctggaaatga-gcagtattacctag
A0A8C2P0X3_BCL2L11      tgtgcttattctggaaatga-gcagtattacctag
                                          ** **            

© 1998-2022Legal notice