Dataset for CDS BCL2L11 of organism Capra hircus

[Download (right click)] [Alignment] [Repertoires]

7 sequence(s)

>gnl|bcl2dbcds|A0A452FCR6_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Capra hircus GN=BCL2L11 (length=588 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgccgagaggcctcctca
gctcagaccaggggcccccacctctttacagacagagcggcaaggtaatcctgaaggagaaggggaccgctgcccccaag
gcagcccgcagggcccgctggccccaccggccagccccggccctttcgctaccagatccccgctcttcatcttcgtgaga
agatcctccttgctgtctcggtcctccagcgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatccacacagaccccaagccctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctc
aggctgtacctgcagatacacgcccagagatatggattgcccaagagctacggcgtatcggagacgagtttaatgcgtat
tacccaagaagggtcttcgtgcgtcaccaggcgattgagggccacccacaaatggtcctcctgcgcgtcttgcgctacct
ggtgcgtctggtgtggaggatgcagtga
>gnl|bcl2dbcds|A0A452FCR6_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Capra hircus GN=BCL2L11 (length=420 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgccgagaggcctcctca
gctcagaccaggggcccccacctctttacagacagagcggcaagacaggagcccggcacccatgagttgtgacaaatcca
cacagaccccaagccctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctcaggctgta
cctgcagatacacgcccagagatatggattgcccaagagctacggcgtatcggagacgagtttaatgcgtattacccaag
aagggtcttcgtgcgtcaccaggcgattgagggccacccacaaatggtcctcctgcgcgtcttgcgctacctggtgcgtc
tggtgtggaggatgcagtga
>gnl|bcl2dbcds|A0A8C2P0X3_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Capra hircus GN=BCL2L11 (length=588 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgccgagaggcctcctca
gctcagaccaggggcccccacctctttacagacagagcggcaaggtaatcctgaaggagaaggggaccgctgcccccaag
gcagcccgcagggcccgctggccccaccagccagccccggccctttcgctaccagatccccgctcttcatcttcgtgaga
agatcctccttgctgtctcggtcctccagcgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatccacacagaccccaagccctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctc
aggctgtacctgcagatacacgcccagagatatggattgcccaagagctacggcgtatcggagacgagtttaatgcgtat
tacccaagaagggtcttcgtgcgtcaccaggcgattgagggccacccacaaatggtcctnnnnnnngtcttgcgctacct
ggtgcgtctggtgtggaggatgcagtga
>gnl|bcl2dbcds|A0A8C2P0X3_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Capra hircus GN=BCL2L11 (length=669 residues).
atgtctgaccctaattcacgaactgagaaacgcaaggctcgttgtgaaggatttatggaacagcgacgaaaaaaagacca
aatggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgccgagaggcctcctc
agctcagaccaggggcccccacctctttacagacagagcggcaaggtaatcctgaaggagaaggggaccgctgcccccaa
ggcagcccgcagggcccgctggccccaccagccagccccggccctttcgctaccagatccccgctcttcatcttcgtgag
aagatcctccttgctgtctcggtcctccagcgggtatttctcttttgacacagacaggagcccggcacccatgagttgtg
acaaatccacacagaccccaagccctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtct
caggctgtacctgcagatacacgcccagagatatggattgcccaagagctacggcgtatcggagacgagtttaatgcgta
ttacccaagaagggtcttcgtgcgtcaccaggcgattgagggccacccacaaatggtcctnnnnnnngtcttgcgctacc
tggtgcgtctggtgtggaggatgcagtga
>gnl|bcl2dbcds|A0A8C2P0X3_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Capra hircus GN=BCL2L11 (length=336 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgccgagaggcctcctca
gctcagaccaggggcccccacctctttacagacagagcggcaagacaggagcccggcacccatgagttgtgacaaatcca
cacagaccccaagccctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctcaggctgta
cctgcagatacacgcccagagatatggattgcccaagagctacggcgtatcggagacgagtttaatgcgtattacccaag
aaggttagagcgctag
>gnl|bcl2dbcds|A0A8C2P0X3_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Capra hircus GN=BCL2L11 (length=1083 residues).
atgggggcttcggctggggagagggtggcctttagggtgcccaccccagcgggcctgcactggggtcggcggccggggct
ggagtctggggccggctctgcgggttctgttttgtctccaggtgaccggctctcgggggcggcgggagctgcagaggcgg
gcgcggcgccaggactgacggaggggaggggcaggtttggctgggcagccccggtcccagaggccccggaaacctccgcc
gccgctcccgccgcagtcagggcccgagccgcgttcggcggcgagtttgtcaacaatcgcctcgccttcggcggcctgtt
ggcaggcgccgcccccgccgccgccaccgattggctgcggctccgagnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngggagctcagagcgcgagtctcgggctttgtttc
ccgcgccgccttcgtgtggactgtcggggggttccagaaaaaaagaccaaatggcaaagcaaccttccgatgtaagttct
gagtgtgacagagaaggtggacaattgcagcctgccgagaggcctcctcagctcagaccaggggcccccacctctttaca
gacagagcggcaagacaggagcccggcacccatgagttgtgacaaatccacacagaccccaagccctccttgccaggcct
tcaaccattatctcagtgcaatggcttccatgaggcagtctcaggctgtacctgcagatacacgcccagagatatggatt
gcccaagagctacggcgtatcggagacgagtttaatgcgtattacccaagaagggtaaatgatgttttctttacctcctt
ttttgattctgtgcttattctggaaatgagcagtattacctag
>gnl|bcl2dbcds|A0A8C2P0X3_BCL2L11-05 BCL2-like 11 gene OS=[Eukaryota] Capra hircus GN=BCL2L11 (length=993 residues).
atgggggcttcggctggggagagggtggcctttagggtgcccaccccagcgggcctgcactggggtcggcggccggggct
ggagtctggggccggctctgcgggttctgttttgtctccaggtgaccggctctcgggggcggcgggagctgcagaggcgg
gcgcggcgccaggactgacggaggggaggggcaggtttggctgggcagccccggtcccagaggccccggaaacctccgcc
gccgctcccgccgcagtcagggcccgagccgcgttcggcggcgagtttgtcaacaatcgcctcgccttcggcggcctgtt
ggcaggcgccgcccccgccgccgccaccgattggctgcggctccgagnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngggagctcagagcgcgagtctcgggctttgtttc
ccgcgccgccttcgtgtggactgtcggggggttccagaaaaaaagaccaaatggcaaagcaaccttccgatgtaagttct
gagtgtgacagagaaggtggacaattgcagcctgccgagaggcctcctcagctcagaccaggggcccccacctctttaca
gacagagcggcaagcttccatgaggcagtctcaggctgtacctgcagatacacgcccagagatatggattgcccaagagc
tacggcgtatcggagacgagtttaatgcgtattacccaagaagggtaaatgatgttttctttacctccttttttgattct
gtgcttattctggaaatgagcagtattacctag
© 1998-2022Legal notice