Dataset for CDS BMF of organism Canis lupus familiaris

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A5F4CJ04_BMF-03      atggagccgcctcagtgtgtggaggagctggaggatgatgtgttccagcc
A0A5F4CJ04_BMF-01      atggagccgcctcagtgtgtggaggagctggaggatgatgtgttccagcc
A0A5F4CJ04_BMF-02      atggagccgcctcagtgtgtggaggagctggaggatgatgtgttccagcc
                       **************************************************

A0A5F4CJ04_BMF-03      agaggatggggagccggggacccagcctgggagcttgctctctgctgacc
A0A5F4CJ04_BMF-01      agaggatggggagccggggacccagcctgggagcttgctctctgctgacc
A0A5F4CJ04_BMF-02      agaggatggggagccggggacccagcctgggagcttgctctctgctgacc
                       **************************************************

A0A5F4CJ04_BMF-03      tgtttgcccagagccagctggactgccccctcagccgtctgcatctcttc
A0A5F4CJ04_BMF-01      tgtttgcccagagccagctggactgccccctcagccgtctgcatctcttc
A0A5F4CJ04_BMF-02      tgtttgcccagagccagctggactgccccctcagccgtctgcatctcttc
                       **************************************************

A0A5F4CJ04_BMF-03      cctctcacccactgctgtggccctgggcttcgacccaccagccaggaaga
A0A5F4CJ04_BMF-01      cctctcacccactgctgtggccctgggcttcgacccaccagccaggaaga
A0A5F4CJ04_BMF-02      cctctcacccactgctgtggccctgggcttcgacccaccagccaggaaga
                       **************************************************

A0A5F4CJ04_BMF-03      caaggccacccagaccctcagtccggcctccccaagtcagggtgtcatgc
A0A5F4CJ04_BMF-01      caaggccacccagaccctcagtccggcctccccaagtcagggtgtcatgc
A0A5F4CJ04_BMF-02      caaggccacccagaccctcagtccggcctccccaagtcagggtgtcatgc
                       **************************************************

A0A5F4CJ04_BMF-03      tgccttgtggggtgaccgaagagccccagcgactcttttatggcaacgct
A0A5F4CJ04_BMF-01      tgccttgtggggtgaccgaagagccccagcgactcttttatggcaacgct
A0A5F4CJ04_BMF-02      tgccttgtggggtgaccgaagagccccagcgactcttttatggcaacgct
                       **************************************************

A0A5F4CJ04_BMF-03      ggctaccggctccctctccctgccagtttccctgcaggcttgcctctcct
A0A5F4CJ04_BMF-01      ggctaccggctccctctccctgccagtttccctgcaggcttgcctctcct
A0A5F4CJ04_BMF-02      ggctaccggctccctctccctgccagtttccctgcaggcttgcctctcct
                       **************************************************

A0A5F4CJ04_BMF-03      cgagcagcccccggaagggcagtggcaacatcgagcagaggtacagattg
A0A5F4CJ04_BMF-01      cgagcagcccccggaagggcagtggcaacatcgagcagaggtacagattg
A0A5F4CJ04_BMF-02      cgagcagcccccggaagggcagtggcaacatcgagcagaggtacagattg
                       **************************************************

A0A5F4CJ04_BMF-03      cccgaaagcttcagtgcattgcagaccagttccatcggcttcacatgcag
A0A5F4CJ04_BMF-01      cccgaaagcttcagtgcattgcagaccagttccatcggcttcacatgcag
A0A5F4CJ04_BMF-02      cccgaaagcttcagtgcattgcagaccagttccatcggcttcacatgcag
                       **************************************************

A0A5F4CJ04_BMF-03      caacaccagcaaaaccaaaatcgagtgtggtggcagattctcctcttcct
A0A5F4CJ04_BMF-01      caacaccagcaaaaccaaaatcgagtgtggtggcagattctcctcttcct
A0A5F4CJ04_BMF-02      caacaccagcaaaaccaaaatcgagtgtggtggcagattctcctcttcct
                       **************************************************

A0A5F4CJ04_BMF-03      gcacaacctggctttgaatgcagatgagaacaggaatggggcaggtccca
A0A5F4CJ04_BMF-01      gcacaacctggctttgaatgcagatgagaacaggaatggggcaggtccca
A0A5F4CJ04_BMF-02      gcacaacctggctttgaatgcagatgagaacaggaatggggcaggtccca
                       **************************************************

A0A5F4CJ04_BMF-03      gc------------------ttccagctagtcccgggaa---tatcgtgc
A0A5F4CJ04_BMF-01      gccaaagcctgcaaatcagattctggagactttcaagaaacttgccttgc
A0A5F4CJ04_BMF-02      gccaaagcctgcaaatcagattctggagactttcaagaaacttgccttgc
                       **                  ***  *  * *  *  ***   *  * ***

A0A5F4CJ04_BMF-03      tctggagctcag---caggattgcagctgcctctga--------------
A0A5F4CJ04_BMF-01      tc----acttcg---gaggccagcta----ccaggatcaggagcctgggg
A0A5F4CJ04_BMF-02      tc----acttcgttcgaagaccacaactccccaggat----------ggt
                       **     **  *    * *    *      *   **              

A0A5F4CJ04_BMF-03      ---
A0A5F4CJ04_BMF-01      tag
A0A5F4CJ04_BMF-02      tag
                          

© 1998-2022Legal notice