Dataset for CDS BMF of organism Canis lupus familiaris

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C0TVZ9_BMF-05      --------------------------------------------------
A0A8C0TVZ9_BMF-01      --------------------------------------------------
A0A8C0TVZ9_BMF-02      --------------------------------------------------
A0A8C0TVZ9_BMF-04      atgggggcccgagaagggttgggctgcgggcgtgtggggggaccatggag
A0A8C0TVZ9_BMF-03      --------------------------------------------------
                                                                         

A0A8C0TVZ9_BMF-05      --------------------------------------------------
A0A8C0TVZ9_BMF-01      --------------------------------------------------
A0A8C0TVZ9_BMF-02      --------------------------------------------------
A0A8C0TVZ9_BMF-04      gactggagcgccggggtgcgggaacgcggtgcaggacccttatctagggg
A0A8C0TVZ9_BMF-03      --------------------------------------------------
                                                                         

A0A8C0TVZ9_BMF-05      --atggagccgcctcagtgtgtggaggagctggaggatgatgtgttccag
A0A8C0TVZ9_BMF-01      --atggagccgcctcagtgtgtggaggagctggaggatgatgtgttccag
A0A8C0TVZ9_BMF-02      --atggagccgcctcagtgtgtggaggagctggaggatgatgtgttccag
A0A8C0TVZ9_BMF-04      agatggagccgcctcagtgtgtggaggagctggaggatgatgtgttccag
A0A8C0TVZ9_BMF-03      --atggagccgcctcagtgtgtggaggagctggaggatgatgtgttccag
                         ************************************************

A0A8C0TVZ9_BMF-05      ccagaggatggggagccggggacccagcctgggagcttgctctctgctga
A0A8C0TVZ9_BMF-01      ccagaggatggggagccggggacccagcctgggagcttgctctctgctga
A0A8C0TVZ9_BMF-02      ccagaggatggggagccggggacccagcctgggagcttgctctctgctga
A0A8C0TVZ9_BMF-04      ccagaggatggggagccggggacccagcctgggagcttgctctctgctga
A0A8C0TVZ9_BMF-03      ccagaggatggggagccggggacccagcctgggagcttgctctctgctga
                       **************************************************

A0A8C0TVZ9_BMF-05      cctgtttgcccagagccagctggactgccccctcagccgtctgcatctct
A0A8C0TVZ9_BMF-01      cctgtttgcccagagccagctggactgccccctcagccgtctgcatctct
A0A8C0TVZ9_BMF-02      cctgtttgcccagagccagctggactgccccctcagccgtctgcatctct
A0A8C0TVZ9_BMF-04      cctgtttgcccagagccagctggactgccccctcagccgtctgcatctct
A0A8C0TVZ9_BMF-03      cctgtttgcccagagccagctggactgccccctcagccgtctgcatctct
                       **************************************************

A0A8C0TVZ9_BMF-05      tccctctcacccactgctgtggccctgggcttcgacccaccagccaggaa
A0A8C0TVZ9_BMF-01      tccctctcacccactgctgtggccctgggcttcgacccaccagccaggaa
A0A8C0TVZ9_BMF-02      tccctctcacccactgctgtggccctgggcttcgacccaccagccaggaa
A0A8C0TVZ9_BMF-04      tccctctcacccactgctgtggccctgggcttcgacccaccagccaggaa
A0A8C0TVZ9_BMF-03      tccctctcacccactgctgtggccctgggcttcgacccaccagccaggaa
                       **************************************************

A0A8C0TVZ9_BMF-05      gacaaggccacccagaccctcagtccggcctccccaagtcagggtgtcat
A0A8C0TVZ9_BMF-01      gacaaggccacccagaccctcagtccggcctccccaagtcagggtgtcat
A0A8C0TVZ9_BMF-02      gacaaggccacccagaccctcagtccggcctccccaagtcagggtgtcat
A0A8C0TVZ9_BMF-04      gacaaggccacccagaccctcagtccggcctccccaagtcagggtgtcat
A0A8C0TVZ9_BMF-03      gacaaggccacccagaccctcagtccggcctccccaagtcagggtgtcat
                       **************************************************

A0A8C0TVZ9_BMF-05      gctgccttgtggggtgaccgaagagccccagcgactcttttatggcaacg
A0A8C0TVZ9_BMF-01      gctgccttgtggggtgaccgaagagccccagcgactcttttatggcaacg
A0A8C0TVZ9_BMF-02      gctgccttgtggggtgaccgaagagccccagcgactcttttatggcaacg
A0A8C0TVZ9_BMF-04      gctgccttgtggggtgaccgaagagccccagcgactcttttatggcaacg
A0A8C0TVZ9_BMF-03      gctgccttgtggggtgaccgaagagccccagcgactcttttatggcaacg
                       **************************************************

A0A8C0TVZ9_BMF-05      ctggctaccggctccctctccctgccagtttccctgcaggcttgcctctc
A0A8C0TVZ9_BMF-01      ctggctaccggctccctctccctgccagtttccctgcaggcttgcctctc
A0A8C0TVZ9_BMF-02      ctggctaccggctccctctccctgccagtttccctgcaggcttgcctctc
A0A8C0TVZ9_BMF-04      ctggctaccggctccctctccctgccagtttccctgcaggcttgcctctc
A0A8C0TVZ9_BMF-03      ctggctaccggctccctctccctgccagtttccctgcaggcttgcctctc
                       **************************************************

A0A8C0TVZ9_BMF-05      ctcgagcagcccccggaagggcagtggcaacatcgagcagaggtacagat
A0A8C0TVZ9_BMF-01      ctcgagcagcccccggaagggcagtggcaacatcgagcagaggtacagat
A0A8C0TVZ9_BMF-02      ctcgagcagcccccggaagggcagtggcaacatcgagcagaggtacagat
A0A8C0TVZ9_BMF-04      ctcgagcagcccccggaagggcagtggcaacatcgagcagaggtacagat
A0A8C0TVZ9_BMF-03      ctcgagcagcccccggaagggcagtggcaacatcgagcagaggtacagat
                       **************************************************

A0A8C0TVZ9_BMF-05      tgcccgaaagcttcagtgcattgcagaccagttccatcggcttcacatgc
A0A8C0TVZ9_BMF-01      tgcccgaaagcttcagtgcattgcagaccagttccatcggcttcacatgc
A0A8C0TVZ9_BMF-02      tgcccgaaagcttcagtgcattgcagaccagttccatcggcttcacatgc
A0A8C0TVZ9_BMF-04      tgcccgaaagcttcagtgcattgcagaccagttccatcggcttcacatgc
A0A8C0TVZ9_BMF-03      tgcccgaaagcttcagtgcattgcagaccagttccatcggcttcacatgc
                       **************************************************

A0A8C0TVZ9_BMF-05      agcaagtaggcatgggagctgggagctgggctggggcgggaggagagtct
A0A8C0TVZ9_BMF-01      agcaa-------------------------caccagcaaaaccaaaatc-
A0A8C0TVZ9_BMF-02      agcaa-------------------------caccagcaaaaccaaaatc-
A0A8C0TVZ9_BMF-04      agcaa-------------------------caccagcaaaaccaaaatc-
A0A8C0TVZ9_BMF-03      agcaa-------------------------caccagcaaaaccaaaatc-
                       *****                         *    **   *  * * ** 

A0A8C0TVZ9_BMF-05      tctggggctggggggtgggggtggaccaggacctgcctcagccactccgt
A0A8C0TVZ9_BMF-01      ----------gagtgtggtggcagatt-----------------ctcc--
A0A8C0TVZ9_BMF-02      ----------gagtgtggtggcagatt-----------------ctcc--
A0A8C0TVZ9_BMF-04      ----------gagtgtggtggcagatt-----------------ctcc--
A0A8C0TVZ9_BMF-03      ----------gagtgtggtggcagatt-----------------ctcc--
                                 * * **** **  **                   ****  

A0A8C0TVZ9_BMF-05      gtctgccgggaccccaagggcatggtcccggggtcttggcctgggctgct
A0A8C0TVZ9_BMF-01      -tcttcctgcac--------------------aacctggctttgaatgca
A0A8C0TVZ9_BMF-02      -tcttcctgcac--------------------aacctggctttgaatgca
A0A8C0TVZ9_BMF-04      -tcttcctgcac--------------------aacctggctttgaatgca
A0A8C0TVZ9_BMF-03      -tcttcctgcac--------------------aacctggctttgaatgca
                        *** ** * **                      * **** * *  *** 

A0A8C0TVZ9_BMF-05      gtggttccggtgaactgggtgggcccaactgt----------ccgagcac
A0A8C0TVZ9_BMF-01      gatgagaacaggaatggggcaggtcccagccaaagcct--------gcaa
A0A8C0TVZ9_BMF-02      gatgagaacaggaatggggcaggtcccagcttccagctagtcccgggaat
A0A8C0TVZ9_BMF-04      gatgagaacaggaatggggcaggtcccag---------------------
A0A8C0TVZ9_BMF-03      gatgagaacaggaatggggcaggtcccagtgtattcattgctgt-----t
                       *  *       ***  ***  ** ** *                      

A0A8C0TVZ9_BMF-05      tcctgccctctcagagctccaagtgggttacctgccgcctctgggctcag
A0A8C0TVZ9_BMF-01      atcagattctggagactttcaagaaacttgcct----------tgctcac
A0A8C0TVZ9_BMF-02      atcgtgctctggagctcagcagga--------t----------tgcagct
A0A8C0TVZ9_BMF-04      --------------------------------------------------
A0A8C0TVZ9_BMF-03      tttttgcgtttgcattttaaaagtgtctctctg----------tgtac--
                                                                         

A0A8C0TVZ9_BMF-05      gcttctaa
A0A8C0TVZ9_BMF-01      ttcggtaa
A0A8C0TVZ9_BMF-02      gcctctga
A0A8C0TVZ9_BMF-04      ----gtga
A0A8C0TVZ9_BMF-03      ----ataa
                            * *

© 1998-2022Legal notice