Dataset for CDS BMF of organism Canis lupus familiaris

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

J9PB65_BMF-04      atgggggcccgagaagggttgggctgcgggcgtgtggggggaccatggaggactggagcg
J9PB65_BMF-03      ------------------------------------------------------------
J9PB65_BMF-02      ------------------------------------------------------------
J9PB65_BMF-01      ------------------------------------------------------------

J9PB65_BMF-04      ccggggtgcgggaacgcggtgcaggacccttatctaggggagatggagccgcctcagtgt
J9PB65_BMF-03      ------------------------------------------atggagccgcctcagtgt
J9PB65_BMF-02      ------------------------------------------atggagccgcctcagtgt
J9PB65_BMF-01      ------------------------------------------atggagccgcctcagtgt

J9PB65_BMF-04      gtggaggagctggaggatgatgtgttccagccagaggatggggagccggggacccagcct
J9PB65_BMF-03      gtggaggagctggaggatgatgtgttccagccagaggatggggagccggggacccagcct
J9PB65_BMF-02      gtggaggagctggaggatgatgtgttccagccagaggatggggagccggggacccagcct
J9PB65_BMF-01      gtggaggagctggaggatgatgtgttccagccagaggatggggagccggggacccagcct

J9PB65_BMF-04      gggagcttgctctctgctgacctgtttgcccagagccagctggactgccccctcagccgt
J9PB65_BMF-03      gggagcttgctctctgctgacctgtttgcccagagccagctggactgccccctcagccgt
J9PB65_BMF-02      gggagcttgctctctgctgacctgtttgcccagagccagctggactgccccctcagccgt
J9PB65_BMF-01      gggagcttgctctctgctgacctgtttgcccagagccagctggactgccccctcagccgt

J9PB65_BMF-04      ctgcatctcttccctctcacccactgctgtggccctgggcttcgacccaccagccaggaa
J9PB65_BMF-03      ctgcatctcttccctctcacccactgctgtggccctgggcttcgacccaccagccaggaa
J9PB65_BMF-02      ctgcatctcttccctctcacccactgctgtggccctgggcttcgacccaccagccaggaa
J9PB65_BMF-01      ctgcatctcttccctctcacccactgctgtggccctgggcttcgacccaccagccaggaa

J9PB65_BMF-04      gacaaggccacccagaccctcagtccggcctccccaagtcagggtgtcatgctgccttgt
J9PB65_BMF-03      gacaaggccacccagaccctcagtccggcctccccaagtcagggtgtcatgctgccttgt
J9PB65_BMF-02      gacaaggccacccagaccctcagtccggcctccccaagtcagggtgtcatgctgccttgt
J9PB65_BMF-01      gacaaggccacccagaccctcagtccggcctccccaagtcagggtgtcatgctgccttgt

J9PB65_BMF-04      ggggtgaccgaagagccccagcgactcttttatggcaacgctggctaccggctccctctc
J9PB65_BMF-03      ggggtgaccgaagagccccagcgactcttttatggcaacgctggctaccggctccctctc
J9PB65_BMF-02      ggggtgaccgaagagccccagcgactcttttatggcaacgctggctaccggctccctctc
J9PB65_BMF-01      ggggtgaccgaagagccccagcgactcttttatggcaacgctggctaccggctccctctc

J9PB65_BMF-04      cctgccagtttccctgcaggcttgcctctcctcgagcagcccccggaagggcagtggcaa
J9PB65_BMF-03      cctgccagtttccctgcaggcttgcctctcctcgagcagcccccggaagggcagtggcaa
J9PB65_BMF-02      cctgccagtttccctgcaggcttgcctctcctcgagcagcccccggaagggcagtggcaa
J9PB65_BMF-01      cctgccagtttccctgcaggcttgcctctcctcgagcagcccccggaagggcagtggcaa

J9PB65_BMF-04      catcgagcagaggtacagattgcccgaaagcttcagtgcattgcagaccagttccatcgg
J9PB65_BMF-03      catcgagcagaggtacagattgcccgaaagcttcagtgcattgcagaccagttccatcgg
J9PB65_BMF-02      catcgagcagaggtacagattgcccgaaagcttcagtgcattgcagaccagttccatcgg
J9PB65_BMF-01      catcgagcagaggtacagattgcccgaaagcttcagtgcattgcagaccagttccatcgg

J9PB65_BMF-04      cttcacatgcagcaacaccagcaaaaccaaaatcgagtgtggtggcagattctcctcttc
J9PB65_BMF-03      cttcacatgcagcaacaccagcaaaaccaaaatcgagtgtggtggcagattctcctcttc
J9PB65_BMF-02      cttcacatgcagcaacaccagcaaaaccaaaatcgagtgtggtggcagattctcctcttc
J9PB65_BMF-01      cttcacatgcagcaacaccagcaaaaccaaaatcgagtgtggtggcagattctcctcttc

J9PB65_BMF-04      ctgcacaacctggctttgaatgcagatgagaacaggaatggggcaggtcccaggtga---
J9PB65_BMF-03      ctgcacaacctggctttgaatgcagatgagaacaggaatggggcaggtcccagc------
J9PB65_BMF-02      ctgcacaacctggctttgaatgcagatgagaacaggaatggggcaggtcccagccaaagc
J9PB65_BMF-01      ctgcacaacctggctttgaatgcagatgagaacaggaatggggcaggtcccagccaaagc

J9PB65_BMF-04      ------------------------------------------------------------
J9PB65_BMF-03      ------------ttccagctagtcccgggaa---tatcgtgctctggagctcag---cag
J9PB65_BMF-02      ctgcaaatcagattctggagactttcaagaaacttgccttgctc----acttcgttcgaa
J9PB65_BMF-01      ctgcaaatcagattctggagactttcaagaaacttgccttgctc----acttcg---gag

J9PB65_BMF-04      -----------------------------------
J9PB65_BMF-03      gattgcagctgcctctga-----------------
J9PB65_BMF-02      gaccacaactccccaggat----------ggttag
J9PB65_BMF-01      gccagcta----ccaggatcaggagcctggggtag

© 1998-2020Legal notice