Dataset for CDS BMF of organism Canis lupus familiaris

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|J9PB65_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Canis lupus familiaris GN=BMF (length=639 residues).
atggagccgcctcagtgtgtggaggagctggaggatgatgtgttccagccagaggatggggagccggggacccagcctgg
gagcttgctctctgctgacctgtttgcccagagccagctggactgccccctcagccgtctgcatctcttccctctcaccc
actgctgtggccctgggcttcgacccaccagccaggaagacaaggccacccagaccctcagtccggcctccccaagtcag
ggtgtcatgctgccttgtggggtgaccgaagagccccagcgactcttttatggcaacgctggctaccggctccctctccc
tgccagtttccctgcaggcttgcctctcctcgagcagcccccggaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccatcggcttcacatgcagcaacaccagcaaaaccaaaatcgagtgtgg
tggcagattctcctcttcctgcacaacctggctttgaatgcagatgagaacaggaatggggcaggtcccagccaaagcct
gcaaatcagattctggagactttcaagaaacttgccttgctcacttcgttcgaagaccacaactccccaggatggttag
>gnl|bcl2dbcds|J9PB65_BMF-04 Bcl2 modifying factor gene OS=[Eukaryota] Canis lupus familiaris GN=BMF (length=657 residues).
atgggggcccgagaagggttgggctgcgggcgtgtggggggaccatggaggactggagcgccggggtgcgggaacgcggt
gcaggacccttatctaggggagatggagccgcctcagtgtgtggaggagctggaggatgatgtgttccagccagaggatg
gggagccggggacccagcctgggagcttgctctctgctgacctgtttgcccagagccagctggactgccccctcagccgt
ctgcatctcttccctctcacccactgctgtggccctgggcttcgacccaccagccaggaagacaaggccacccagaccct
cagtccggcctccccaagtcagggtgtcatgctgccttgtggggtgaccgaagagccccagcgactcttttatggcaacg
ctggctaccggctccctctccctgccagtttccctgcaggcttgcctctcctcgagcagcccccggaagggcagtggcaa
catcgagcagaggtacagattgcccgaaagcttcagtgcattgcagaccagttccatcggcttcacatgcagcaacacca
gcaaaaccaaaatcgagtgtggtggcagattctcctcttcctgcacaacctggctttgaatgcagatgagaacaggaatg
gggcaggtcccaggtga
>gnl|bcl2dbcds|J9PB65_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Canis lupus familiaris GN=BMF (length=642 residues).
atggagccgcctcagtgtgtggaggagctggaggatgatgtgttccagccagaggatggggagccggggacccagcctgg
gagcttgctctctgctgacctgtttgcccagagccagctggactgccccctcagccgtctgcatctcttccctctcaccc
actgctgtggccctgggcttcgacccaccagccaggaagacaaggccacccagaccctcagtccggcctccccaagtcag
ggtgtcatgctgccttgtggggtgaccgaagagccccagcgactcttttatggcaacgctggctaccggctccctctccc
tgccagtttccctgcaggcttgcctctcctcgagcagcccccggaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccatcggcttcacatgcagcaacaccagcaaaaccaaaatcgagtgtgg
tggcagattctcctcttcctgcacaacctggctttgaatgcagatgagaacaggaatggggcaggtcccagccaaagcct
gcaaatcagattctggagactttcaagaaacttgccttgctcacttcggaggccagctaccaggatcaggagcctggggt
ag
>gnl|bcl2dbcds|J9PB65_BMF-03 Bcl2 modifying factor gene OS=[Eukaryota] Canis lupus familiaris GN=BMF (length=612 residues).
atggagccgcctcagtgtgtggaggagctggaggatgatgtgttccagccagaggatggggagccggggacccagcctgg
gagcttgctctctgctgacctgtttgcccagagccagctggactgccccctcagccgtctgcatctcttccctctcaccc
actgctgtggccctgggcttcgacccaccagccaggaagacaaggccacccagaccctcagtccggcctccccaagtcag
ggtgtcatgctgccttgtggggtgaccgaagagccccagcgactcttttatggcaacgctggctaccggctccctctccc
tgccagtttccctgcaggcttgcctctcctcgagcagcccccggaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccatcggcttcacatgcagcaacaccagcaaaaccaaaatcgagtgtgg
tggcagattctcctcttcctgcacaacctggctttgaatgcagatgagaacaggaatggggcaggtcccagcttccagct
agtcccgggaatatcgtgctctggagctcagcaggattgcagctgcctctga
© 1998-2020Legal notice