Dataset for CDS classical BH3-containing proteins of organism Canis lupus dingo

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C0JZ72_BMF-01       atggagccgcctcagtgtgtgg------------aggagctggaggatga
A0A8C0JZ72_BMF-02       atggagccgcctcagtgtgtgg------------aggagctggaggatga
A0A8C0KNS8_BAD-01       atgttccagatcccagagtttg------------agcccagtgagcagga
A0A8C0L0H0_HRK-01       atgtgcccgtgcc-------------------------------------
A0A8C0L1H3_PMAIP1-      atg-----------------------------------------------
A0A8C0L5G0_BCL2L11      atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtgg
A0A8C0L5G0_BCL2L11      atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtgg
                        ***                                               

A0A8C0JZ72_BMF-01       tgtgttccagccagaggatggggagccggggacccagcc-----tgggag
A0A8C0JZ72_BMF-02       tgtgttccagccagaggatggggagccggggacccagcc-----tgggag
A0A8C0KNS8_BAD-01       agactccagccctgcaaataggg-gcttgggccccagccccacaggggac
A0A8C0L0H0_HRK-01       ---------ccctgca---------------ccgcggcc----------g
A0A8C0L1H3_PMAIP1-      ---------cccggccggaaggc-------gcgcaag-------------
A0A8C0L5G0_BCL2L11      acaattgcagcctgctgagaggcctcctcagctcaggcc----------t
A0A8C0L5G0_BCL2L11      acaattgcagcctgctgagaggcctcctcagctcaggcc----------t
                                  ** *                      *             

A0A8C0JZ72_BMF-01       cttgctctctgctgacctgtttgcccagagccagctggactgccccctca
A0A8C0JZ72_BMF-02       cttgctctctgctgacctgtttgcccagagccagctggactgccccctca
A0A8C0KNS8_BAD-01       cggcccccaagccc-------tggcaagcaccagc-agacggcccc--ag
A0A8C0L0H0_HRK-01       cgggcccccggccg-------tgt---gcgcctgc-ag-----cgc--gg
A0A8C0L1H3_PMAIP1-      --------------------------------------------------
A0A8C0L5G0_BCL2L11      ggggcccctacctc-------tctacagacagaacagca-----------
A0A8C0L5G0_BCL2L11      ggggcccctacctc-------tctacagacagaacagcaaggtaatcctg
                                                                          

A0A8C0JZ72_BMF-01       gccgtct------------------------gcatctcttccctctcacc
A0A8C0JZ72_BMF-02       gccgtct------------------------gcatctcttccctctcacc
A0A8C0KNS8_BAD-01       gcctcctaggggaagctggtcaccagcaggggcagccagccagccgcaaa
A0A8C0L0H0_HRK-01       gccgcct-------------------------------------------
A0A8C0L1H3_PMAIP1-      --------------------------------------------------
A0A8C0L5G0_BCL2L11      --------------------------------------------------
A0A8C0L5G0_BCL2L11      aaggcgaaggggaccgctgcccccaaggcagccctcagggcccgctggcc
                                                                          

A0A8C0JZ72_BMF-01       cactgctgtggccctgg-----------------gcttcgacccaccagc
A0A8C0JZ72_BMF-02       cactgctgtggccctgg-----------------gcttcgacccaccagc
A0A8C0KNS8_BAD-01       caccatggaggcgctggggctgagacccggagtcgccacagctcgttccc
A0A8C0L0H0_HRK-01       ---------ggctctg-----------------------cgctcgtccgc
A0A8C0L1H3_PMAIP1-      --------------------------------------------------
A0A8C0L5G0_BCL2L11      --------------------------------------------------
A0A8C0L5G0_BCL2L11      ccaccagccagccccggcccttttgctaccagatccccgcttttcatctt
                                                                          

A0A8C0JZ72_BMF-01       cagga---------------------------------------------
A0A8C0JZ72_BMF-02       cagga---------------------------------------------
A0A8C0KNS8_BAD-01       cgcgg---------------------------------------------
A0A8C0L0H0_HRK-01       cgcgc---------------------------------------------
A0A8C0L1H3_PMAIP1-      --------------------------------------------------
A0A8C0L5G0_BCL2L11      --------------------------------------------------
A0A8C0L5G0_BCL2L11      tgtgagaagatcctccctgctgtctcgatcctccagtgggtatttctctt
                                                                          

A0A8C0JZ72_BMF-01       -------agac------------------------aaggccacccagacc
A0A8C0JZ72_BMF-02       -------agac------------------------aaggccacccagacc
A0A8C0KNS8_BAD-01       -------ggaccgacgaggatgaaggaatggaggaagaagagctcagccc
A0A8C0L0H0_HRK-01       -------agctc-----------------------acggccgctcggctc
A0A8C0L1H3_PMAIP1-      -------ag--------------------------cgcgcagcccggccc
A0A8C0L5G0_BCL2L11      -------ag--------------------------acaggagcccggcac
A0A8C0L5G0_BCL2L11      ttgacacag--------------------------acaggagcccggcac
                                *                                 * * *  *

A0A8C0JZ72_BMF-01       ctca-------gtccg--------gcctccccaagtcagggtgtcatg--
A0A8C0JZ72_BMF-02       ctca-------gtccg--------gcctccccaagtcagggtgtcatg--
A0A8C0KNS8_BAD-01       tttccgggggcgctcgagctcagcgccccccaacctctgcgcggcacggc
A0A8C0L0H0_HRK-01       ------aaggcgctcg------gcgacgagctgcaccagcgcaccatgtg
A0A8C0L1H3_PMAIP1-      c-------------------acgcgggcccc------------cgaag--
A0A8C0L5G0_BCL2L11      ccatgagttgtgacaaatcaacacaaaccccaagtcctccttgccagg--
A0A8C0L5G0_BCL2L11      ccatgagttgtgacaaatcaacacaaaccccaagtcctccttgccagg--
                                                      *              * *  

A0A8C0JZ72_BMF-01       ----ctgccttgtggggtgaccgaagagccccagcgactcttttatggca
A0A8C0JZ72_BMF-02       ----ctgccttgtggggtgaccgaagagccccagcgactcttttatggca
A0A8C0KNS8_BAD-01       gctacggccgcgagctccgcaggatgag----------------------
A0A8C0L0H0_HRK-01       gcggc-gccgcgcgcggagccgga-ggg----------------------
A0A8C0L1H3_PMAIP1-      ------agctcga----------a-gtg----------------------
A0A8C0L5G0_BCL2L11      ------ccttcaaccattatctca-gtg----------------------
A0A8C0L5G0_BCL2L11      ------ccttcaaccattatctca-gtg----------------------
                                               * * *                      

A0A8C0JZ72_BMF-01       acgctggctaccggctccctctccctgccagtttccctgcaggcttgcct
A0A8C0JZ72_BMF-02       acgctggctaccggctccctctccctgccagtttccctgcaggcttgcct
A0A8C0KNS8_BAD-01       -cgacgagttccagggctccttcaa--------------------gggac
A0A8C0L0H0_HRK-01       -cgccggcgccccgcgcgctcccc------------------------ac
A0A8C0L1H3_PMAIP1-      -gagtg--tgcca-------------------------------------
A0A8C0L5G0_BCL2L11      -caatggcttcca-------------------------------------
A0A8C0L5G0_BCL2L11      -caatggcttcca-------------------------------------
                             *    **                                      

A0A8C0JZ72_BMF-01       ctcctcgagcagcccccggaagggcagtggcaacatcgagcagaggtaca
A0A8C0JZ72_BMF-02       ctcctcgagcagcccccggaagggcagtggcaacatcgagcagaggtaca
A0A8C0KNS8_BAD-01       ttcctcg------cccgaagagcgcggggacagcgacg----------ca
A0A8C0L0H0_HRK-01       ctactgg------ccctggctgtgcg----cggccgcg----------ca
A0A8C0L1H3_PMAIP1-      ----ttcagc----------------------------tcaggaaat---
A0A8C0L5G0_BCL2L11      ----tgaggcagtctcaggctgtacctgcagatatgcgcccggagatatg
A0A8C0L5G0_BCL2L11      ----tgaggcagtctcaggctgtacctgcagatatgcgcccggagatatg
                            *                                             

A0A8C0JZ72_BMF-01       gat---tgcccgaaagcttcagtgcattgcagaccagttccatcggcttc
A0A8C0JZ72_BMF-02       gat---tgcccgaaagcttcagtgcattgcagaccagttccatcggcttc
A0A8C0KNS8_BAD-01       gat----gcgacaaagccccagc---------------------------
A0A8C0L0H0_HRK-01       ggtggcggcgctggcggcctggc---------------------------
A0A8C0L1H3_PMAIP1-      --------------------------ttggagacaaactgaat-------
A0A8C0L5G0_BCL2L11      gat---tgcacaagagttgcggcgtattggagacgaatttaatgcatatt
A0A8C0L5G0_BCL2L11      gat---tgcacaagagttgcggcgtattggagacgaatttaatgcatatt
                                                                          

A0A8C0JZ72_BMF-01       atatgcagcaacaccagcaaaaccaaaatcgagtgtggtggcagattctc
A0A8C0JZ72_BMF-02       atatgcagcaacaccagcaaaaccaaaatcgagtgtggtggcagattctc
A0A8C0KNS8_BAD-01       -----------------------------------tggacgcgcgtcatc
A0A8C0L0H0_HRK-01       -----------------------------------tg-------------
A0A8C0L1H3_PMAIP1-      --------------------------------------------------
A0A8C0L5G0_BCL2L11      acccaaggagg--------gtctttttgaataatta-ccaagcagccgaa
A0A8C0L5G0_BCL2L11      acccaaggagggtaatgatgttttatttactacttctcctcacaccctcc
                                                                          

A0A8C0JZ72_BMF-01       ctcttcctgcacaac-------ctggctttgaatgcagatg---------
A0A8C0JZ72_BMF-02       ctcttcctgcacaac-------ctggctttgaatgcagatg---------
A0A8C0KNS8_BAD-01       cagtcctggtgggat-------cggaacttg---------g---------
A0A8C0L0H0_HRK-01       ----ctcggcagg---------cggaacttg---------t---------
A0A8C0L1H3_PMAIP1-      ---ttccggcagaaactt----ctgaatctgttatccaaactcttccgct
A0A8C0L5G0_BCL2L11      gcccacccccaaatgattatc-ttacgactgttacgttacatcgtccgcc
A0A8C0L5G0_BCL2L11      ccctccccacaattttttttctttaaggttactagtaaaaattccatact
                                                     *                    

A0A8C0JZ72_BMF-01       ------agaacaggaatggggcaggtcccaggtga
A0A8C0JZ72_BMF-02       ------agaacaggaatggggcaggtcccaggtga
A0A8C0KNS8_BAD-01       ------ggagaggaggctccgccccgtcccagtga
A0A8C0L0H0_HRK-01       ------ag---------------------------
A0A8C0L1H3_PMAIP1-      ca----ggaac--------------------ctga
A0A8C0L5G0_BCL2L11      tggtgtggagattgca---------------gtga
A0A8C0L5G0_BCL2L11      tattctggaaa-tgcaaggtattacctatatgtga
                               *                           

© 1998-2022Legal notice