Dataset for CDS classical BH3-containing proteins of organism Canis lupus dingo

[Download (right click)] [Alignment] [Repertoires]

7 sequence(s)

>gnl|bcl2dbcds|A0A8C0JZ72_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Canis lupus dingo GN=BMF (length=555 residues).
atggagccgcctcagtgtgtggaggagctggaggatgatgtgttccagccagaggatggggagccggggacccagcctgg
gagcttgctctctgctgacctgtttgcccagagccagctggactgccccctcagccgtctgcatctcttccctctcaccc
actgctgtggccctgggcttcgacccaccagccaggaagacaaggccacccagaccctcagtccggcctccccaagtcag
ggtgtcatgctgccttgtggggtgaccgaagagccccagcgactcttttatggcaacgctggctaccggctccctctccc
tgccagtttccctgcaggcttgcctctcctcgagcagcccccggaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccatcggcttcatatgcagcaacaccagcaaaaccaaaatcgagtgtgg
tggcagattctcctcttcctgcacaacctggctttgaatgcagatgagaacaggaatggggcaggtcccaggtga
>gnl|bcl2dbcds|A0A8C0JZ72_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Canis lupus dingo GN=BMF (length=555 residues).
atggagccgcctcagtgtgtggaggagctggaggatgatgtgttccagccagaggatggggagccggggacccagcctgg
gagcttgctctctgctgacctgtttgcccagagccagctggactgccccctcagccgtctgcatctcttccctctcaccc
actgctgtggccctgggcttcgacccaccagccaggaagacaaggccacccagaccctcagtccggcctccccaagtcag
ggtgtcatgctgccttgtggggtgaccgaagagccccagcgactcttttatggcaacgctggctaccggctccctctccc
tgccagtttccctgcaggcttgcctctcctcgagcagcccccggaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccatcggcttcatatgcagcaacaccagcaaaaccaaaatcgagtgtgg
tggcagattctcctcttcctgcacaacctggctttgaatgcagatgagaacaggaatggggcaggtcccaggtga
>gnl|bcl2dbcds|A0A8C0KNS8_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Canis lupus dingo GN=BAD (length=504 residues).
atgttccagatcccagagtttgagcccagtgagcaggaagactccagccctgcaaataggggcttgggccccagccccac
aggggaccggcccccaagccctggcaagcaccagcagacggccccaggcctcctaggggaagctggtcaccagcaggggc
agccagccagccgcaaacaccatggaggcgctggggctgagacccggagtcgccacagctcgttccccgcggggaccgac
gaggatgaaggaatggaggaagaagagctcagccctttccgggggcgctcgagctcagcgccccccaacctctgcgcggc
acggcgctacggccgcgagctccgcaggatgagcgacgagttccagggctccttcaagggacttcctcgcccgaagagcg
cggggacagcgacgcagatgcgacaaagccccagctggacgcgcgtcatccagtcctggtgggatcggaacttggggaga
ggaggctccgccccgtcccagtga
>gnl|bcl2dbcds|A0A8C0L0H0_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Canis lupus dingo GN=HRK (length=276 residues).
atgtgcccgtgccccctgcaccgcggccgcgggcccccggccgtgtgcgcctgcagcgcgggccgcctggctctgcgctc
gtccgccgcgcagctcacggccgctcggctcaaggcgctcggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccggcgccccgcgcgctccccacctactggccctggctgtgcgcggccgcgcaggtggcggcg
ctggcggcctggctgctcggcaggcggaacttgtag
>gnl|bcl2dbcds|A0A8C0L1H3_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Canis lupus dingo GN=PMAIP1 (length=165 residues).
atgcccggccggaaggcgcgcaagagcgcgcagcccggccccacgcgggcccccgaagagctcgaagtggagtgtgccat
tcagctcaggaaatttggagacaaactgaatttccggcagaaacttctgaatctgttatccaaactcttccgctcaggaa
cctga
>gnl|bcl2dbcds|A0A8C0L5G0_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Canis lupus dingo GN=BCL2L11 (length=423 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagaacagcaagacaggagcccggcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctcaggctgta
cctgcagatatgcgcccggagatatggattgcacaagagttgcggcgtattggagacgaatttaatgcatattacccaag
gagggtctttttgaataattaccaagcagccgaagcccacccccaaatgattatcttacgactgttacgttacatcgtcc
gcctggtgtggagattgcagtga
>gnl|bcl2dbcds|A0A8C0L5G0_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Canis lupus dingo GN=BCL2L11 (length=615 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagaacagcaaggtaatcctgaaggcgaaggggaccgctgcccccaag
gcagccctcagggcccgctggccccaccagccagccccggcccttttgctaccagatccccgcttttcatctttgtgaga
agatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctc
aggctgtacctgcagatatgcgcccggagatatggattgcacaagagttgcggcgtattggagacgaatttaatgcatat
tacccaaggagggtaatgatgttttatttactacttctcctcacaccctccccctccccacaattttttttctttaaggt
tactagtaaaaattccatacttattctggaaatgcaaggtattacctatatgtga
© 1998-2022Legal notice