Dataset for CDS classical BH3-containing proteins of organism Buteo japonicus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C0B3C7_BCL2L11      at-----------gctgttgagaggcgagctgtcccgg------------
A0A8C0AW70_BMF-01       atggatcgccccagctacctggaagaggactattctagcctggatgggct
A0A8C0HKC1_PMAIP1-      -------cccccagcctc--------------------------------
                                     **                                   

A0A8C0B3C7_BCL2L11      --------------ttccctccgacggat-----------ggaaagtcct
A0A8C0AW70_BMF-01       ggacgatgacgtgtttcactctgatgactttggacttgcaggtcagcctg
A0A8C0HKC1_PMAIP1-      --------------------------------------------------
                                                                          

A0A8C0B3C7_BCL2L11      tcagtttgctggaagcagggtttctcggcgtacaaatccagt--tgtggc
A0A8C0AW70_BMF-01       gtgagatgactgcaactggcatttt---cacacagaaccagtcctacagc
A0A8C0HKC1_PMAIP1-      ---------------------ttct---tcctcagcaccagt--------
                                             ** *       **   *****        

A0A8C0B3C7_BCL2L11      tttcttctcagtacgacaaaaccgatcgctttcctttttcttgttgtgca
A0A8C0AW70_BMF-01       tgccttctggggaggtttcaactattccccctca--cacactgctgtggt
A0A8C0HKC1_PMAIP1-      ----------ggagg-----------------------------------
                                  * * *                                   

A0A8C0B3C7_BCL2L11      cttcagaacggtttggggaggaaatgtgagaatgtgattaaactatccag
A0A8C0AW70_BMF-01       cccggtatcaggcatcctgagcagcaggacaaggcaactcaaacactcag
A0A8C0HKC1_PMAIP1-      ---------------------------------------------ctcag
                                                                       ***

A0A8C0B3C7_BCL2L11      gcagaggttttttaaggttagggaaggagctgctgctgtgcctgcaagaa
A0A8C0AW70_BMF-01       cccg-----------------------------tcctcttccagtcagga
A0A8C0HKC1_PMAIP1-      tgcg----------------------------------------------
                           *                                              

A0A8C0B3C7_BCL2L11      aagaaggttatttag-------aaagagggaaagagaaggttttgctagg
A0A8C0AW70_BMF-01       tgttatgttgccttgtggagtcactgaagagccccggagactcttctatg
A0A8C0HKC1_PMAIP1-      --------------------------------------------------
                                                                          

A0A8C0B3C7_BCL2L11      gaaagaaagtggagcgtggcatctcagctttcctccct----atttaata
A0A8C0AW70_BMF-01       gcaa-----tgctggttaccgtttacacgtccctccagttggctttgcgt
A0A8C0HKC1_PMAIP1-      ------------------------------ccctgcag------ctgcgc
                                                       *** *         *    

A0A8C0B3C7_BCL2L11      ggggaccaaacttcccggtggcagtctcactcactagcagaagatgtaca
A0A8C0AW70_BMF-01       tggatccgcacctccaagagg-agcctcaggaaggtcagcgggaagcgcg
A0A8C0HKC1_PMAIP1-      aggatcggcg---acaagtgg-gacct-----------gcgg--------
                         **  *        *  * **    **                       

A0A8C0B3C7_BCL2L11      gcccgaaatctggattgcacaggagctgcggcgcattggagatgagtt-c
A0A8C0AW70_BMF-01       tgccgaggtgcagattgcacggaagttgcagtgcattgccgaccagttcc
A0A8C0HKC1_PMAIP1-      -------------------cagaagatcctgaac----------------
                                           * * ** * * *  *                

A0A8C0B3C7_BCL2L11      aatgcctcctattgtccaagaaggggtttcttggataaccaggcaggaaa
A0A8C0AW70_BMF-01       accggctcca------catacagaggcatc------agcagaacagaaat
A0A8C0HKC1_PMAIP1-      -----ctcct------cacgaag---------------------------
                             ****       **   **                           

A0A8C0B3C7_BCL2L11      cccccagatcatca--ttttgcgcctcctgcgttacatcatccgcctcat
A0A8C0AW70_BMF-01       caagtgtggtggcagctttttctcttcctacacaacttggcc--ttaaac
A0A8C0HKC1_PMAIP1-      ------------------ctattcttcc----------------------
                                           *   * ***                      

A0A8C0B3C7_BCL2L11      ctggagga--------------------tgcagtga
A0A8C0AW70_BMF-01       gcggaggcgaacaggaaccacactgggcagaggtga
A0A8C0HKC1_PMAIP1-      -cggagac------------------------gtga
                          ****                          ****

© 1998-2022Legal notice