Dataset for CDS classical BH3-containing proteins of organism Buteo japonicus

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A8C0AW70_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Buteo japonicus GN=BMF (length=582 residues).
atggatcgccccagctacctggaagaggactattctagcctggatgggctggacgatgacgtgtttcactctgatgactt
tggacttgcaggtcagcctggtgagatgactgcaactggcattttcacacagaaccagtcctacagctgccttctgggga
ggtttcaactattccccctcacacactgctgtggtcccggtatcaggcatcctgagcagcaggacaaggcaactcaaaca
ctcagcccgtcctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccccggagactcttctatggcaa
tgctggttaccgtttacacgtccctccagttggctttgcgttggatccgcacctccaagaggagcctcaggaaggtcagc
gggaagcgcgtgccgaggtgcagattgcacggaagttgcagtgcattgccgaccagttccaccggctccacatacagagg
catcagcagaacagaaatcaagtgtggtggcagctttttctcttcctacacaacttggccttaaacgcggaggcgaacag
gaaccacactgggcagaggtga
>gnl|bcl2dbcds|A0A8C0B3C7_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Buteo japonicus GN=BCL2L11 (length=552 residues).
atgctgttgagaggcgagctgtcccggttccctccgacggatggaaagtccttcagtttgctggaagcagggtttctcgg
cgtacaaatccagttgtggctttcttctcagtacgacaaaaccgatcgctttcctttttcttgttgtgcacttcagaacg
gtttggggaggaaatgtgagaatgtgattaaactatccaggcagaggttttttaaggttagggaaggagctgctgctgtg
cctgcaagaaaagaaggttatttagaaagagggaaagagaaggttttgctagggaaagaaagtggagcgtggcatctcag
ctttcctccctatttaataggggaccaaacttcccggtggcagtctcactcactagcagaagatgtacagcccgaaatct
ggattgcacaggagctgcggcgcattggagatgagttcaatgcctcctattgtccaagaaggggtttcttggataaccag
gcaggaaacccccagatcatcattttgcgcctcctgcgttacatcatccgcctcatctggaggatgcagtga
>gnl|bcl2dbcds|A0A8C0HKC1_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Buteo japonicus GN=PMAIP1 (length=132 residues).
cccccagcctcttcttcctcagcaccagtggaggctcagtgcgccctgcagctgcgcaggatcggcgacaagtgggacct
gcggcagaagatcctgaacctcctcacgaagctattcttcccggagacgtga
© 1998-2022Legal notice