Dataset for CDS classical BH3-containing proteins of organism Balaenoptera musculus

[Download (right click)] [Edit] [Sequences] [Repertoires]

9 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C0D9H2_PMAIP1-      atg---------cct--------------------------ggaaggagg
A0A8B8Z6B1_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtgg
A0A8B8Z6B1_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtgg
A0A8B8Z6B1_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtgg
A0A8B8Z6B1_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtgg
A0A8B8Z7R2_HRK-01       atg-----------------------------------------------
A0A8C0I683_BBC3-01      atggcc------c-------------------gagcacgccaggagggca
A0A8B8Y772_BAD-01       atgttc------cagatcccagagtttgagcagagtgagcaggaaga---
A0A8C0CL26_BMF-01       atggag------cc-accccagtgtgtg----gag-gagctggaggatga
                        ***                                               

A0A8C0D9H2_PMAIP1-      gc------------tcgtaagagc------gctcag--------------
A0A8B8Z6B1_BCL2L11      acaattgcagcctgccgaaaggcctcctcagctcaggcctggggccccca
A0A8B8Z6B1_BCL2L11      acaattgcagcctgccgaaaggcctcctcagctcaggcctggggccccca
A0A8B8Z6B1_BCL2L11      acaattgcagcctgccgaaaggcctcctcagctcaggcctggggccccca
A0A8B8Z6B1_BCL2L11      acaattgcagcctgccgaaaggcctcctcagctcaggcctggggccccca
A0A8B8Z7R2_HRK-01       -----------------------------------tgcccgtgccccctg
A0A8C0I683_BBC3-01      gctctcccgagcccgtagagggcctggcccgcgacggcccgcgtcccttc
A0A8B8Y772_BAD-01       ----ctccagccctgcagatagg------------g-gcctgggccccag
A0A8C0CL26_BMF-01       tgtgttccagcca-gaggatggg------------gagccggggacccag
                                                                          

A0A8C0D9H2_PMAIP1-      ------------cagag---------------------------------
A0A8B8Z6B1_BCL2L11      tctctctacagacagagcggcaa---------------------------
A0A8B8Z6B1_BCL2L11      tctctctacagacagagcggcaaggtaatcccgaaggagaaggggaccgc
A0A8B8Z6B1_BCL2L11      tctctctacagacagagcggcaaggtaatcccgaaggagaaggggaccgc
A0A8B8Z6B1_BCL2L11      tctctctacagacagagcggca----------------------------
A0A8B8Z7R2_HRK-01       caccgcggccg---------------------------------------
A0A8C0I683_BBC3-01      cccctcagccgcctggtgccctcggccgtatcctgcggcctctgcgaacc
A0A8B8Y772_BAD-01       ccccacaggggacagg----------------------------------
A0A8C0CL26_BMF-01       cctggcag------------------------------------------
                                                                          

A0A8C0D9H2_PMAIP1-      --------------------------------------------------
A0A8B8Z6B1_BCL2L11      --------------------------------------------------
A0A8B8Z6B1_BCL2L11      tgcccccaaggcagcccgca------------------------------
A0A8B8Z6B1_BCL2L11      tgcccccaaggcagcccgca------------------------------
A0A8B8Z6B1_BCL2L11      --------------------------------------------------
A0A8B8Z7R2_HRK-01       cggcccgccggcggtgtgcg----------cctgcag-----cgcgggcc
A0A8C0I683_BBC3-01      cggcctgcctgccgcccccgccgcccccgccctgctg-----ccc--gcc
A0A8B8Y772_BAD-01       cccccaggtcccagcaagca----------cccgcaaacggccccaggcc
A0A8C0CL26_BMF-01       ---cttgctctctgctg--a----------cctgt---ttgcccagagcc
                                                                          

A0A8C0D9H2_PMAIP1-      --------------------------------------------------
A0A8B8Z6B1_BCL2L11      --------------------------------------------------
A0A8B8Z6B1_BCL2L11      -----gggcccactggccccaccagccagtcccggccctttcgctaccag
A0A8B8Z6B1_BCL2L11      -----gggcccactggccccaccagccagtcccggccctttcgctaccag
A0A8B8Z6B1_BCL2L11      --------------------------------------------------
A0A8B8Z7R2_HRK-01       gcctggg----tctgcgctcgtccgccgcg-cagc------tcacggccg
A0A8C0I683_BBC3-01      gcctacc----tctgcgccc--ccaccgcc-ccgcccgccgtcaccgccg
A0A8B8Y772_BAD-01       tcctgggggaagctggtcac--cagcagggacagccagccagcagcagcc
A0A8C0CL26_BMF-01       agctgg-----actgccccc--t--------cagcc-gtctgcagctctt
                                                                          

A0A8C0D9H2_PMAIP1-      --------------------------------------------------
A0A8B8Z6B1_BCL2L11      --------------------------------------------------
A0A8B8Z6B1_BCL2L11      atccccgcttttcatcttcgtgagaagatcttccctgctgtctcgatcct
A0A8B8Z6B1_BCL2L11      atccccgcttttcatcttcgtgagaagatcttccctgctgtctcgatcct
A0A8B8Z6B1_BCL2L11      --------------------------------------------------
A0A8B8Z7R2_HRK-01       ccc---------------ggctcaaggcgctcggcgacg----agctgc-
A0A8C0I683_BBC3-01      ccctgggggccccccgctggcctgggggtcctcgcagcc----ggccccg
A0A8B8Y772_BAD-01       accatggaggcactgg--ggctgtggagacccggagtcgccacagcttct
A0A8C0CL26_BMF-01       ccctctcacgcact-----gctgtgg---ccctg---------ggcttcg
                                                                          

A0A8C0D9H2_PMAIP1-      --------------------------------------------------
A0A8B8Z6B1_BCL2L11      --------------------------------------------------
A0A8B8Z6B1_BCL2L11      ccagtgggtatttctcttttgacacagacaggagcccggcacccatgagt
A0A8B8Z6B1_BCL2L11      ccagtgggtatttctcttttgacacagacaggagcccggcacccatgagt
A0A8B8Z6B1_BCL2L11      -------------------------agacaggagcccggcacccatgagt
A0A8B8Z7R2_HRK-01       --accagcgcaccatgtggcggcgc--------------cgcgcgcggag
A0A8C0I683_BBC3-01      aggcccgcgcccc----gacggtcctcagccctcactctcgcccgcggag
A0A8B8Y772_BAD-01       actccgcggggac--------------------------ggaggatgaag
A0A8C0CL26_BMF-01       acccaccagcca--------------------------------------
                                                                          

A0A8C0D9H2_PMAIP1-      --------------------------------------------------
A0A8B8Z6B1_BCL2L11      --------------------------------------------------
A0A8B8Z6B1_BCL2L11      tgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaacca
A0A8B8Z6B1_BCL2L11      tgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaacca
A0A8B8Z6B1_BCL2L11      tgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaacca
A0A8B8Z7R2_HRK-01       -----ccggagggcgccggcgcccagcgcgct------------------
A0A8C0I683_BBC3-01      cagcacctggaatcgccagtgcccagcgcccc--gggggccctggcggg-
A0A8B8Y772_BAD-01       aagggacggaggaggagga-gcccagccccttccggggccgctcgcgct-
A0A8C0CL26_BMF-01       -------ggaagacaaggctacccagactctc-------------agtc-
                                                                          

A0A8C0D9H2_PMAIP1-      ---------------------cccgacgcgggccccggcagatcctgaag
A0A8B8Z6B1_BCL2L11      ----------------gcttccatgaggcagtctcaggctgtacctgcag
A0A8B8Z6B1_BCL2L11      ttatctcagtgcgatggcttccatgaggcagtctcaggctgtacctgcag
A0A8B8Z6B1_BCL2L11      ttatctcagtgcgatggcttccatgaggcagtctcaggctgtacctgcag
A0A8B8Z6B1_BCL2L11      ttatctcagtgcgatggcttccatgaggcagtctcaggctgtacctgcag
A0A8B8Z7R2_HRK-01       -----------------ccccacctac-tggccctgg-------------
A0A8C0I683_BBC3-01      --------------cggccccacccaagcggccccgggagtccgggggga
A0A8B8Y772_BAD-01       --------------cggcgccccccaa-----cctctgggctgcacagcg
A0A8C0CL26_BMF-01       --------------cagcctccccaag-----ccagggtgtcatgctgcc
                                                 *      *                 

A0A8C0D9H2_PMAIP1-      -----------------ttgagtgtgccattcagttcaggagaattggag
A0A8B8Z6B1_BCL2L11      atatgcgtccggagatatggattgcgcaag--agttgcggcgtattggag
A0A8B8Z6B1_BCL2L11      atatgcgtccggagatatggattgcgcaag--agttgcggcgtattggag
A0A8B8Z6B1_BCL2L11      atatgcgtccggagatatggattgcgcaag--agttgcggcgtattggag
A0A8B8Z6B1_BCL2L11      atatgcgtccggagatatggattgcgcaag--agttgcggcgtattggag
A0A8B8Z7R2_HRK-01       ------------------------ctgtgcgcggccgc-gcaggtggcg-
A0A8C0I683_BBC3-01      ggaggagcagtgggcccgagagatcggggcccagctgcggcggatggcgg
A0A8B8Y772_BAD-01       atatggccgcgagctccggaggatgagcgacgagttcca-cggctccttc
A0A8C0CL26_BMF-01       ttgtg---------------gggtgactgaggaaccccagcgactctttt
                                                                    *     

A0A8C0D9H2_PMAIP1-      acaaactgaat--------ttccggcagaaacttctgaatttgatatcca
A0A8B8Z6B1_BCL2L11      acgaatttaatgcatattacccaaggagg------ctgacagaatgcctg
A0A8B8Z6B1_BCL2L11      acgaatttaatgcatattacccaaggaggtt-------------------
A0A8B8Z6B1_BCL2L11      acgaatttaatgcatattacccaaggagggtctttctgaataatcaccaa
A0A8B8Z6B1_BCL2L11      acgaatttaatgcatattacccaaggagggtctttctgaataatcaccaa
A0A8B8Z7R2_HRK-01       -----------gcg-------ctg--------------------------
A0A8C0I683_BBC3-01      acgatctcaacgcg-------ctgtacgagcggcggagacaagaggagca
A0A8B8Y772_BAD-01       aagggacttcctcg-------cccgaagagcg--cgggcacagcgacgca
A0A8C0CL26_BMF-01       atgcaccagcagaa-------ccgaaatcgtg--tgtg------------
                                             *                            

A0A8C0D9H2_PMAIP1-      a----------------------------------actcttcc-------
A0A8B8Z6B1_BCL2L11      gcagcc----------------------------------tac-------
A0A8B8Z6B1_BCL2L11      --------------------------------------------------
A0A8B8Z6B1_BCL2L11      gcagccgaaggtcacccgcaaatggttatcttacgactgttac-------
A0A8B8Z6B1_BCL2L11      gcagccgaaggtcacccgcaaatggttatcttacgactgttac-------
A0A8B8Z7R2_HRK-01       ---gcggcttggct------------------------------------
A0A8C0I683_BBC3-01      gcagcgacaccgcccctccccctggagggtcctgtacaatctcatcatgg
A0A8B8Y772_BAD-01       gatgcgacaaagccccagttgggcgcgcttcctt--caatcctggtg---
A0A8C0CL26_BMF-01       ---gtggcagatcctc---------ctctttctgcacaacctcgctgtg-
                                                                          

A0A8C0D9H2_PMAIP1-      -----------------------------gctcgggaacc----------
A0A8B8Z6B1_BCL2L11      -----------------------------acc------------------
A0A8B8Z6B1_BCL2L11      --------------------------------------------------
A0A8B8Z6B1_BCL2L11      -----------------------------gccacatcatccgtctggtgt
A0A8B8Z6B1_BCL2L11      -----------------------------gccacatcatccgtctggtgt
A0A8B8Z7R2_HRK-01       -----------------------------gctcggcaggcggaa------
A0A8C0I683_BBC3-01      gactcctgcccttacccaggggccgcggagccccggagatggag------
A0A8B8Y772_BAD-01       ---------------------gaaccggaacttggggagaggaggccccg
A0A8C0CL26_BMF-01       -------------aatggagagaacaggaa--tggggcagg---------
                                                                          

A0A8C0D9H2_PMAIP1-      -----------tga
A0A8B8Z6B1_BCL2L11      -----------tga
A0A8B8Z6B1_BCL2L11      ----agagcaatag
A0A8B8Z6B1_BCL2L11      ggaggatgcagtga
A0A8B8Z6B1_BCL2L11      ggaggatgcagtga
A0A8B8Z7R2_HRK-01       -----cttg--tag
A0A8C0I683_BBC3-01      -----cccaattag
A0A8B8Y772_BAD-01       ccccctcccagtga
A0A8C0CL26_BMF-01       -----tcccag---
                                      

© 1998-2022Legal notice