Dataset for CDS classical BH3-containing proteins of organism Balaenoptera musculus

[Download (right click)] [Alignment] [Repertoires]

9 sequence(s)

>gnl|bcl2dbcds|A0A8B8Y772_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Balaenoptera musculus GN=BAD (length=507 residues).
atgttccagatcccagagtttgagcagagtgagcaggaagactccagccctgcagataggggcctgggccccagccccac
aggggacaggcccccaggtcccagcaagcacccgcaaacggccccaggcctcctgggggaagctggtcaccagcagggac
agccagccagcagcagccaccatggaggcactggggctgtggagacccggagtcgccacagcttctactccgcggggacg
gaggatgaagaagggacggaggaggaggagcccagccccttccggggccgctcgcgctcggcgccccccaacctctgggc
tgcacagcgatatggccgcgagctccggaggatgagcgacgagttccacggctccttcaagggacttcctcgcccgaaga
gcgcgggcacagcgacgcagatgcgacaaagccccagttgggcgcgcttccttcaatcctggtggaaccggaacttgggg
agaggaggccccgccccctcccagtga
>gnl|bcl2dbcds|A0A8B8Z6B1_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Balaenoptera musculus GN=BCL2L11 (length=591 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgccgaaaggcctcctca
gctcaggcctggggcccccatctctctacagacagagcggcaaggtaatcccgaaggagaaggggaccgctgcccccaag
gcagcccgcagggcccactggccccaccagccagtcccggccctttcgctaccagatccccgcttttcatcttcgtgaga
agatcttccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcgatggcttccatgaggcagtctc
aggctgtacctgcagatatgcgtccggagatatggattgcgcaagagttgcggcgtattggagacgaatttaatgcatat
tacccaaggagggtctttctgaataatcaccaagcagccgaaggtcacccgcaaatggttatcttacgactgttacgcca
catcatccgtctggtgtggaggatgcagtga
>gnl|bcl2dbcds|A0A8B8Z6B1_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Balaenoptera musculus GN=BCL2L11 (length=423 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgccgaaaggcctcctca
gctcaggcctggggcccccatctctctacagacagagcggcaagacaggagcccggcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcgatggcttccatgaggcagtctcaggctgta
cctgcagatatgcgtccggagatatggattgcgcaagagttgcggcgtattggagacgaatttaatgcatattacccaag
gagggtctttctgaataatcaccaagcagccgaaggtcacccgcaaatggttatcttacgactgttacgccacatcatcc
gtctggtgtggaggatgcagtga
>gnl|bcl2dbcds|A0A8B8Z6B1_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Balaenoptera musculus GN=BCL2L11 (length=504 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgccgaaaggcctcctca
gctcaggcctggggcccccatctctctacagacagagcggcaaggtaatcccgaaggagaaggggaccgctgcccccaag
gcagcccgcagggcccactggccccaccagccagtcccggccctttcgctaccagatccccgcttttcatcttcgtgaga
agatcttccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcgatggcttccatgaggcagtctc
aggctgtacctgcagatatgcgtccggagatatggattgcgcaagagttgcggcgtattggagacgaatttaatgcatat
tacccaaggaggttagagcaatag
>gnl|bcl2dbcds|A0A8B8Z6B1_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Balaenoptera musculus GN=BCL2L11 (length=264 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgccgaaaggcctcctca
gctcaggcctggggcccccatctctctacagacagagcggcaagcttccatgaggcagtctcaggctgtacctgcagata
tgcgtccggagatatggattgcgcaagagttgcggcgtattggagacgaatttaatgcatattacccaaggaggctgaca
gaatgcctggcagcctacacctga
>gnl|bcl2dbcds|A0A8B8Z7R2_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Balaenoptera musculus GN=HRK (length=276 residues).
atgtgcccgtgccccctgcaccgcggccgcggcccgccggcggtgtgcgcctgcagcgcgggccgcctgggtctgcgctc
gtccgccgcgcagctcacggccgcccggctcaaggcgctcggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccggcgcccagcgcgctccccacctactggccctggctgtgcgcggccgcgcaggtggcggcg
ctggcggcttggctgctcggcaggcggaacttgtag
>gnl|bcl2dbcds|A0A8C0CL26_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Balaenoptera musculus GN=BMF (length=387 residues).
atggagccaccccagtgtgtggaggagctggaggatgatgtgttccagccagaggatggggagccggggacccagcctgg
cagcttgctctctgctgacctgtttgcccagagccagctggactgccccctcagccgtctgcagctcttccctctcacgc
actgctgtggccctgggcttcgacccaccagccaggaagacaaggctacccagactctcagtccagcctccccaagccag
ggtgtcatgctgccttgtggggtgactgaggaaccccagcgactcttttatgcaccagcagaaccgaaatcgtgtgtggt
ggcagatcctcctctttctgcacaacctcgctgtgaatggagagaacaggaatggggcaggtcccag
>gnl|bcl2dbcds|A0A8C0D9H2_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Balaenoptera musculus GN=PMAIP1 (length=165 residues).
atgcctggaaggagggctcgtaagagcgctcagcagagcccgacgcgggccccggcagatcctgaagttgagtgtgccat
tcagttcaggagaattggagacaaactgaatttccggcagaaacttctgaatttgatatccaaactcttccgctcgggaa
cctga
>gnl|bcl2dbcds|A0A8C0I683_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Balaenoptera musculus GN=BBC3 (length=582 residues).
atggcccgagcacgccaggagggcagctctcccgagcccgtagagggcctggcccgcgacggcccgcgtcccttccccct
cagccgcctggtgccctcggccgtatcctgcggcctctgcgaacccggcctgcctgccgcccccgccgcccccgccctgc
tgcccgccgcctacctctgcgcccccaccgccccgcccgccgtcaccgccgccctgggggccccccgctggcctgggggt
cctcgcagccggccccgaggcccgcgccccgacggtcctcagccctcactctcgcccgcggagcagcacctggaatcgcc
agtgcccagcgccccgggggccctggcgggcggccccacccaagcggccccgggagtccggggggaggaggagcagtggg
cccgagagatcggggcccagctgcggcggatggcggacgatctcaacgcgctgtacgagcggcggagacaagaggagcag
cagcgacaccgcccctccccctggagggtcctgtacaatctcatcatgggactcctgcccttacccaggggccgcggagc
cccggagatggagcccaattag
© 1998-2022Legal notice