Dataset for CDS classical BH3-containing proteins of organism Anser brachyrhynchus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8B9I6Q1_BCL2L11      --------------------------------------------------
A0A8B9BPF5_BMF-01       atggatcgccccagctacctggaagaggactattctagcctggatgggct
A0A8B9CHC1_PMAIP1-      --------------------------------------------------
                                                                          

A0A8B9I6Q1_BCL2L11      ----------------cagcgcg----------------aggccagg---
A0A8B9BPF5_BMF-01       ggacgatgacgtgtttcactctgatgactttggacttgcaggtcagcctg
A0A8B9CHC1_PMAIP1-      -----------tttttcactctg---------------------------
                                        **    *                           

A0A8B9I6Q1_BCL2L11      --------------------------------------------------
A0A8B9BPF5_BMF-01       gtgagatgactgcaacaggcattttcacacagaaccagtcctacagctgc
A0A8B9CHC1_PMAIP1-      --------------------------------------------------
                                                                          

A0A8B9I6Q1_BCL2L11      -----------------------------------cctccgtgggcacgc
A0A8B9BPF5_BMF-01       cttctggggaggtttcaactatttcccctcacacactgctgtggtcccgg
A0A8B9CHC1_PMAIP1-      -------------------------ccc-------ctgttgtg-------
                                                           *    ***       

A0A8B9I6Q1_BCL2L11      c--cagaaatatggattg------------------------ca------
A0A8B9BPF5_BMF-01       tgtcaggcatcctgagcagcaggacaaggcaactcaaacactcagcccgt
A0A8B9CHC1_PMAIP1-      ---ca---atgctgagcg------------------------cagcccgg
                           **   **   **                           **      

A0A8B9I6Q1_BCL2L11      -----------cagga-gctgcggcgcattggagatgaattcaatgcctc
A0A8B9BPF5_BMF-01       cctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccc
A0A8B9CHC1_PMAIP1-      c---------tcgggacgcggtg-------gcggagt-------------
                                   * *** *    *       *  **               

A0A8B9I6Q1_BCL2L11      ------ctattgtccgagaagggtaattttcttat--------ttttact
A0A8B9BPF5_BMF-01       cggagactcttctatgggaacgctggttaccgtttacacgtccctccagt
A0A8B9CHC1_PMAIP1-      -----------------gcgcgctgg---------------------agc
                                         *   * *                       *  

A0A8B9I6Q1_BCL2L11      ttccatttctttaca--------------------cttagtagggttttc
A0A8B9BPF5_BMF-01       tggctttgcattggatccacacctccaagaggagcctcaggaaggtcagc
A0A8B9CHC1_PMAIP1-      tg---------------------------------cgcaggatcggcgac
                        *                                  *  ** *  *    *

A0A8B9I6Q1_BCL2L11      aatcagcacttctcttacctgtaaatacc--taatgctaccccaaatcca
A0A8B9BPF5_BMF-01       aggaggcgcgt-gcggaggtgcagattgcacggaagttgcagtgcattgc
A0A8B9CHC1_PMAIP1-      aaggcggacct-gcg-----acaga------ggatcctgaacctcatcgc
                        *    *  * *  *        * *        *   *       **   

A0A8B9I6Q1_BCL2L11      acttcatttgcatc------------------------------------
A0A8B9BPF5_BMF-01       agaccagttccaccggctccacatacagaggcatcagcagaacagaaatc
A0A8B9CHC1_PMAIP1-      aaagctgttctgcc------------------------------------
                        *   *  **    *                                    

A0A8B9I6Q1_BCL2L11      ----atgcaaatagcctatttcctgctgac--------------------
A0A8B9BPF5_BMF-01       aagtgtggtggcagctttttctctttctacacaacttggccttaaatgtg
A0A8B9CHC1_PMAIP1-      --------------------------------------------------
                                                                          

A0A8B9I6Q1_BCL2L11      ------------------------------tga
A0A8B9BPF5_BMF-01       gaggcgaacaggaaccacactgggcagaggtga
A0A8B9CHC1_PMAIP1-      --------------cca--------aaacgtga
                                                      ***

© 1998-2022Legal notice