Dataset for CDS classical BH3-containing proteins of organism Anser brachyrhynchus

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A8B9BPF5_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Anser brachyrhynchus GN=BMF (length=582 residues).
atggatcgccccagctacctggaagaggactattctagcctggatgggctggacgatgacgtgtttcactctgatgactt
tggacttgcaggtcagcctggtgagatgactgcaacaggcattttcacacagaaccagtcctacagctgccttctgggga
ggtttcaactatttcccctcacacactgctgtggtcccggtgtcaggcatcctgagcagcaggacaaggcaactcaaaca
ctcagcccgtcctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccccggagactcttctatgggaa
cgctggttaccgtttacacgtccctccagttggctttgcattggatccacacctccaagaggagcctcaggaaggtcagc
aggaggcgcgtgcggaggtgcagattgcacggaagttgcagtgcattgcagaccagttccaccggctccacatacagagg
catcagcagaacagaaatcaagtgtggtggcagctttttctctttctacacaacttggccttaaatgtggaggcgaacag
gaaccacactgggcagaggtga
>gnl|bcl2dbcds|A0A8B9CHC1_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Anser brachyrhynchus GN=PMAIP1 (length=156 residues).
tttttcactctgcccctgttgtgcaatgctgagcgcagcccggctcgggacgcggtggcggagtgcgcgctggagctgcg
caggatcggcgacaaggcggacctgcgacagaggatcctgaacctcatcgcaaagctgttctgccccaaaacgtga
>gnl|bcl2dbcds|A0A8B9I6Q1_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Anser brachyrhynchus GN=BCL2L11 (length=243 residues).
cagcgcgaggccaggcctccgtgggcacgcccagaaatatggattgcacaggagctgcggcgcattggagatgaattcaa
tgcctcctattgtccgagaagggtaattttcttatttttactttccatttctttacacttagtagggttttcaatcagca
cttctcttacctgtaaatacctaatgctaccccaaatccaacttcatttgcatcatgcaaatagcctatttcctgctgac
tga
© 1998-2022Legal notice