Dataset for CDS classical BH3-containing proteins of organism Anolis carolinensis

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A803SRF0_BCL2L11      atg-----------------------------------------------
A0A803TSK5_PMAIP1-      atg-----------------------------------------------
A0A803SZ00_BMF-01       atggatcctcccggctacttggatgatgacttctccactttggatgggct
A0A803SZ00_BMF-02       atggatcctcccggctacttggatgatgacttctccactttggatgggct
A0A803SZ00_BMF-03       atggatcctcccggctacttggatgatgacttctccactttggatgggct
                        ***                                               

A0A803SRF0_BCL2L11      --------------------------------------------cagcca
A0A803TSK5_PMAIP1-      --------------------------------------------------
A0A803SZ00_BMF-01       ggaggatgatgtgttccatgcagaagactgtggacttgccagtcaaccca
A0A803SZ00_BMF-02       ggaggatgatgtgttccatgcagaagactgtggacttgccagtcaaccca
A0A803SZ00_BMF-03       ggaggatgatgtgttccatgcagaagactgtggacttgccagtcaaccca
                                                                          

A0A803SRF0_BCL2L11      gaaatatggattgcacaggaattacggcgca-------------------
A0A803TSK5_PMAIP1-      --------------cctggtct----------agaaagtcataaa-----
A0A803SZ00_BMF-01       gtgagatgacctttcctggcattttcactcagagcaaatcctacaactgt
A0A803SZ00_BMF-02       gtgagatgacctttcctggcattttcactcagagcaaatcctacaactgt
A0A803SZ00_BMF-03       gtgagatgacctttcctggcattttcactcagagcaaatcctacaactgt
                                       * **  *                            

A0A803SRF0_BCL2L11      --tcggagatgaattcaatgcttcccactgtc------------------
A0A803TSK5_PMAIP1-      --tctgagg--------------------------------------tgg
A0A803SZ00_BMF-01       cttctggggaggttccagctcttcccacttacacactgttgtggccctgg
A0A803SZ00_BMF-02       cttctggggaggttccagctcttcccacttacacactgttgtggccctgg
A0A803SZ00_BMF-03       cttctggggaggttccagctcttcccacttacacactgttgtggccctgg
                          ** * *                                          

A0A803SRF0_BCL2L11      ---caagaagggtaa---------------------aacatt--------
A0A803TSK5_PMAIP1-      cggcag------------------------------aatgcgca------
A0A803SZ00_BMF-01       cagtaggcaggccaggcagcaagacaaggcaacacaaacactcaacccat
A0A803SZ00_BMF-02       cagtaggcaggccaggcagcaagacaaggcaacacaaacactcaacccat
A0A803SZ00_BMF-03       cagtaggcaggccaggcagcaagacaaggcaacacaaacactcaacccat
                            *                               **            

A0A803SRF0_BCL2L11      ----ttttaaaaaaaa-------ttatttgctgtaatcc-------aatt
A0A803TSK5_PMAIP1-      ----ttgcaactgaga-gtgat---------tggagaca-agtggaacct
A0A803SZ00_BMF-01       cctcttccagccaggatgtgatgttaccttgtggagtcacagaagaaccc
A0A803SZ00_BMF-02       cctcttccagccaggatgtgatgttaccttgtggagtcacagaagaaccc
A0A803SZ00_BMF-03       cctcttccagccaggatgtgatgttaccttgtggagtcacagaagaaccc
                            **  *      *               ** *  *        *   

A0A803SRF0_BCL2L11      ctaaaacttt-------gtatgcagagaaaagtacacata----------
A0A803TSK5_PMAIP1-      ccgaca---------gaggatcctaaacatgatttccaag----------
A0A803SZ00_BMF-01       cagagactcttctatgggaatgctgggtaccgtttacacgtcagcccaat
A0A803SZ00_BMF-02       cagagactcttctatgggaatgctgggtaccgtttacacgtcagcccaat
A0A803SZ00_BMF-03       cagagactcttctatgggaatgctgggtaccgtttacacgtcagcccaat
                        *  * *           * ** *     *   *   **            

A0A803SRF0_BCL2L11      --------------------------------------aggatggtttat
A0A803TSK5_PMAIP1-      --------------atcttc-tgcccaggaag------aggagag-----
A0A803SZ00_BMF-01       tggtttctcattgaatccacacttccaggaggagccccaggagagtccac
A0A803SZ00_BMF-02       tggtttctcattgaatccacacttccaggaggagccccaggagagtccac
A0A803SZ00_BMF-03       tggtttctcattgaatccacacttccaggaggagccccaggagagtccac
                                                              ****  *     

A0A803SRF0_BCL2L11      catgccttcat---------------------------------------
A0A803TSK5_PMAIP1-      --------------------------------------------------
A0A803SZ00_BMF-01       aggaactgcgtactgaagttcagattgcacggaagttgcagtgcattgca
A0A803SZ00_BMF-02       aggaactgcgtactgaagttcagattgcacggaagttgcagtgcattgca
A0A803SZ00_BMF-03       aggaactgcgtactgaagttcagattgcacggaagttgcagtgcattgca
                                                                          

A0A803SRF0_BCL2L11      ----------aaagctctcacctaga------------------------
A0A803TSK5_PMAIP1-      --------------------------------------------------
A0A803SZ00_BMF-01       gaccagttccacaggcttcacctacagaggcacaacatgggcctccttct
A0A803SZ00_BMF-02       gaccagttccacaggcttcacctacagaggcaccagcagaa---------
A0A803SZ00_BMF-03       gaccagttccacaggcttcacctacagaggcaccagcagaa---------
                                                                          

A0A803SRF0_BCL2L11      --------------------------------------------------
A0A803TSK5_PMAIP1-      --------------------------------------------------
A0A803SZ00_BMF-01       ctggacatcttcagaaagaggat----gggcagatccctcctgtggatgc
A0A803SZ00_BMF-02       -----------cagaaaccaggtctggtggcagat-cttcttcttcctcc
A0A803SZ00_BMF-03       -----------cagaaaccaggtctggtggcagat-cttcttcttcctcc
                                                                          

A0A803SRF0_BCL2L11      --------------------------------------------------
A0A803TSK5_PMAIP1-      --------------------------------------------------
A0A803SZ00_BMF-01       tttacctggcgatcctgcac---taagcaaaga---attgaactcaatgg
A0A803SZ00_BMF-02       ataacgtggc---cttgaacatggaggcaaacagacatcgtgct-----g
A0A803SZ00_BMF-03       ataacgtggc---cttgaacatggaggcaaacagacatcgtgct-----g
                                                                          

A0A803SRF0_BCL2L11      --------------------------------------------------
A0A803TSK5_PMAIP1-      --------------------------------------------------
A0A803SZ00_BMF-01       tccaaagggcccctttcaactctatgcctcttag----------------
A0A803SZ00_BMF-02       gccgtagttgtaccacaacctattttccttttactgagcctccggtgtgt
A0A803SZ00_BMF-03       gccgtagg------------------------------------------
                                                                          

A0A803SRF0_BCL2L11      ---------------------------------------------taa
A0A803TSK5_PMAIP1-      ---------------------------------------------tga
A0A803SZ00_BMF-01       ------------------------------------------------
A0A803SZ00_BMF-02       tttccattctctgaaatgctgccaagattctgtctagaggctatctga
A0A803SZ00_BMF-03       ---------------------------------------------tga
                                                                        

© 1998-2022Legal notice