Dataset for CDS classical BH3-containing proteins of organism Anolis carolinensis

[Download (right click)] [Alignment] [Repertoires]

5 sequence(s)

>gnl|bcl2dbcds|A0A803SRF0_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Anolis carolinensis GN=BCL2L11 (length=195 residues).
atgcagccagaaatatggattgcacaggaattacggcgcatcggagatgaattcaatgcttcccactgtccaagaagggt
aaaacattttttaaaaaaaattatttgctgtaatccaattctaaaactttgtatgcagagaaaagtacacataaggatgg
tttatcatgccttcataaagctctcacctagataa
>gnl|bcl2dbcds|A0A803SZ00_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Anolis carolinensis GN=BMF (length=624 residues).
atggatcctcccggctacttggatgatgacttctccactttggatgggctggaggatgatgtgttccatgcagaagactg
tggacttgccagtcaacccagtgagatgacctttcctggcattttcactcagagcaaatcctacaactgtcttctgggga
ggttccagctcttcccacttacacactgttgtggccctggcagtaggcaggccaggcagcaagacaaggcaacacaaaca
ctcaacccatcctcttccagccaggatgtgatgttaccttgtggagtcacagaagaaccccagagactcttctatgggaa
tgctgggtaccgtttacacgtcagcccaattggtttctcattgaatccacacttccaggaggagccccaggagagtccac
aggaactgcgtactgaagttcagattgcacggaagttgcagtgcattgcagaccagttccacaggcttcacctacagagg
cacaacatgggcctccttctctggacatcttcagaaagaggatgggcagatccctcctgtggatgctttacctggcgatc
ctgcactaagcaaagaattgaactcaatggtccaaagggcccctttcaactctatgcctcttag
>gnl|bcl2dbcds|A0A803SZ00_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Anolis carolinensis GN=BMF (length=669 residues).
atggatcctcccggctacttggatgatgacttctccactttggatgggctggaggatgatgtgttccatgcagaagactg
tggacttgccagtcaacccagtgagatgacctttcctggcattttcactcagagcaaatcctacaactgtcttctgggga
ggttccagctcttcccacttacacactgttgtggccctggcagtaggcaggccaggcagcaagacaaggcaacacaaaca
ctcaacccatcctcttccagccaggatgtgatgttaccttgtggagtcacagaagaaccccagagactcttctatgggaa
tgctgggtaccgtttacacgtcagcccaattggtttctcattgaatccacacttccaggaggagccccaggagagtccac
aggaactgcgtactgaagttcagattgcacggaagttgcagtgcattgcagaccagttccacaggcttcacctacagagg
caccagcagaacagaaaccaggtctggtggcagatcttcttcttcctccataacgtggccttgaacatggaggcaaacag
acatcgtgctggccgtagttgtaccacaacctattttccttttactgagcctccggtgtgttttccattctctgaaatgc
tgccaagattctgtctagaggctatctga
>gnl|bcl2dbcds|A0A803SZ00_BMF-03 Bcl2 modifying factor gene OS=[Eukaryota] Anolis carolinensis GN=BMF (length=582 residues).
atggatcctcccggctacttggatgatgacttctccactttggatgggctggaggatgatgtgttccatgcagaagactg
tggacttgccagtcaacccagtgagatgacctttcctggcattttcactcagagcaaatcctacaactgtcttctgggga
ggttccagctcttcccacttacacactgttgtggccctggcagtaggcaggccaggcagcaagacaaggcaacacaaaca
ctcaacccatcctcttccagccaggatgtgatgttaccttgtggagtcacagaagaaccccagagactcttctatgggaa
tgctgggtaccgtttacacgtcagcccaattggtttctcattgaatccacacttccaggaggagccccaggagagtccac
aggaactgcgtactgaagttcagattgcacggaagttgcagtgcattgcagaccagttccacaggcttcacctacagagg
caccagcagaacagaaaccaggtctggtggcagatcttcttcttcctccataacgtggccttgaacatggaggcaaacag
acatcgtgctggccgtaggtga
>gnl|bcl2dbcds|A0A803TSK5_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Anolis carolinensis GN=PMAIP1 (length=141 residues).
atgcctggtctagaaagtcataaatctgaggtggcggcagaatgcgcattgcaactgagagtgattggagacaagtggaa
cctccgacagaggatcctaaacatgatttccaagatcttctgcccaggaagaggagagtga
© 1998-2022Legal notice