Dataset for CDS classical BH3-containing proteins of organism Anas zonorhyncha

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8B9UZ84_PMAIP1-      atg--------------ccgtgcaggaccctgcgcaaacctgcacaaccc
A0A8B9VXZ3_BCL2L11      -----tcctcctcctcgcc------------gtcgtcgtc------gtcg
A0A8B9VVW8_BCL2L11      ctg------------caccaggcagaaga--aatacagccagaaatatgg
A0A8B9VI07_BMF-02       atggatcgccccagctacctggaagaggactattctagcctgg---atgg
A0A8B9VI07_BMF-01       atggatcgccccagctacctggaagaggactattctagcctgg---atgg
A0A8B9VI07_BMF-03       atggatcgccccagctacctggaagaggactattctagcctgg---atgg
                                         **                    *          

A0A8B9UZ84_PMAIP1-      tccgcagaacggca------------------------------------
A0A8B9VXZ3_BCL2L11      gccgccgcccggcccgtctctc---------------cctgcagcccgcc
A0A8B9VVW8_BCL2L11      attgcaca--------------------------ggagctgcggcgcatt
A0A8B9VI07_BMF-02       gctggacgatgacgtgtttcactctgatgactttggacttgcaggtcagc
A0A8B9VI07_BMF-01       gctggacgatgacgtgtttcactctgatgactttggacttgcaggtcagc
A0A8B9VI07_BMF-03       gctggacgatgacgtgtttcactctgatgactttggacttgca-------
                           *                                              

A0A8B9UZ84_PMAIP1-      ----ggcggtggc-------------------------------------
A0A8B9VXZ3_BCL2L11      --------gcgggctcagccg---------------------ccgcccgc
A0A8B9VVW8_BCL2L11      ----ggagatgaattcaatg----------------------cctcctat
A0A8B9VI07_BMF-02       ctggtgagatgactgcaacaggcattttcacacagaaccagtcctacagc
A0A8B9VI07_BMF-01       ctggtgagatgactgcaacaggcattttcacacagaaccagtcctacagc
A0A8B9VI07_BMF-03       --------------------------------------------------
                                                                          

A0A8B9UZ84_PMAIP1-      --------------------------------------------------
A0A8B9VXZ3_BCL2L11      cagccccgg-----------------------------------------
A0A8B9VVW8_BCL2L11      tgtccaagaagggtaattttcttatttttactt-----------------
A0A8B9VI07_BMF-02       tgccttctggggaggtttcaactatttcccctcacacactgctgtggtcc
A0A8B9VI07_BMF-01       tgccttctggggaggtttcaactatttcccctcacacactgctgtggtcc
A0A8B9VI07_BMF-03       --------------------------------------------------
                                                                          

A0A8B9UZ84_PMAIP1-      --------------------------------------------------
A0A8B9VXZ3_BCL2L11      ------------------------------------------------cc
A0A8B9VVW8_BCL2L11      ------------------------------------------------tc
A0A8B9VI07_BMF-02       cggtgtcaggcatcctgagcagcaggacaaggcaactcaaacactcagcc
A0A8B9VI07_BMF-01       cggtgtcaggcatcctgagcagcaggacaaggcaactcaaacactcagcc
A0A8B9VI07_BMF-03       --------------------------------------------------
                                                                          

A0A8B9UZ84_PMAIP1-      --------------------------------------------------
A0A8B9VXZ3_BCL2L11      cgttcgccacc---------------------------------------
A0A8B9VVW8_BCL2L11      catttctttacacttagt--------------------------------
A0A8B9VI07_BMF-02       cgtcctcttccagtcaggatgttatgttgccttgtggagtcactgaagag
A0A8B9VI07_BMF-01       cgtcctcttccagtcaggatgttatgttgccttgtggagtcactgaagag
A0A8B9VI07_BMF-03       --------------------------------------------------
                                                                          

A0A8B9UZ84_PMAIP1-      -------------------ggagtgcgcgct-------------------
A0A8B9VXZ3_BCL2L11      -----------------------cgctcgccgctcttca---------tc
A0A8B9VVW8_BCL2L11      ---------ctctaaaagggaaaagcttaatcatatctggaaactagctc
A0A8B9VI07_BMF-02       ccccggagactcttctatgggaatgctggttaccgtttaca---cgtccc
A0A8B9VI07_BMF-01       ccccggagactcttctatgggaatgctggttaccgtttaca---cgtccc
A0A8B9VI07_BMF-03       ------------------gggaatgctggttaccgtttaca---cgtccc
                                                **                        

A0A8B9UZ84_PMAIP1-      -------ggagctgcgccggatcgg-------cgacaagg----------
A0A8B9VXZ3_BCL2L11      ttcgccgagcgcagccccgcgcccatgagctgcgacaaggccacgcaga-
A0A8B9VVW8_BCL2L11      tgcggcaagtgtttcgtt-cactca--aatgtagaaaaggatgcgcgggt
A0A8B9VI07_BMF-02       tccagttggctttgcattggatcca--cacctccaagaggagcctcagga
A0A8B9VI07_BMF-01       tccagttggctttgcattggatcca--cacctccaagaggagcctcagga
A0A8B9VI07_BMF-03       tccagttggctttgcattggatcca--cacctccaagaggagcctcagga
                                *     *                   *  ***          

A0A8B9UZ84_PMAIP1-      ---------------------------------cggactt------tcga
A0A8B9VXZ3_BCL2L11      ---------cccccagc----------------ccgccctgccaggccgt
A0A8B9VVW8_BCL2L11      ggttgcattcacccgggtgcaggggcgtgctgcctgcgttgcggagttgc
A0A8B9VI07_BMF-02       aggt---------cagcaggaggcgcgtg----ctgaggtgcagattgca
A0A8B9VI07_BMF-01       aggt---------cagcaggaggcgcgtg----ctgaggtgcagattgca
A0A8B9VI07_BMF-03       aggt---------cagcaggaggcgcgtg----ctgaggtgcagattgca
                                                         * *   *          

A0A8B9UZ84_PMAIP1-      cagcggatcc-tgaacctcat-----------------------------
A0A8B9VXZ3_BCL2L11      cagccactacctgagcgccatgggtgacttaatgcaagtttcacaacctt
A0A8B9VVW8_BCL2L11      ccgctgttgc---agtgtcac-------taaa------------------
A0A8B9VI07_BMF-02       cggaagttgc---agtg-cat-------tgcagaccagttccaccggctc
A0A8B9VI07_BMF-01       cggaagttgc---agtg-cat-------tgcagaccagttccaccggctc
A0A8B9VI07_BMF-03       cggaagttgc---agtg-cat-------tgcagaccagttccaccggctc
                        * *    * *   *    **                              

A0A8B9UZ84_PMAIP1-      ----------cacaaa----------------------------------
A0A8B9VXZ3_BCL2L11      gtgtagcaaacacacg-----tggcaccgcc------agacaagga----
A0A8B9VVW8_BCL2L11      ------cgcactcaga------gtcaccagcgagttgggaccggagactt
A0A8B9VI07_BMF-02       ------cacatacagagggtagggtgtttcc------aaaggggaa----
A0A8B9VI07_BMF-01       ------cacatacaga------ggcatcagc------agaacagaaatca
A0A8B9VI07_BMF-03       ------cacatacaga------ggcatcagc------agaacagaaatca
                                    **                                    

A0A8B9UZ84_PMAIP1-      ---------gctgttctgcc----------------------acaaaacg
A0A8B9VXZ3_BCL2L11      -----tgctggagtt---------------------------gtgcagca
A0A8B9VVW8_BCL2L11      ccagttatcgcagctttgttcccagtaccaagagcca-----gtaaagca
A0A8B9VI07_BMF-02       -----ggtgggggct-----tacttatccaggagtggtgctcctgaagcc
A0A8B9VI07_BMF-01       agtgtggtggcagctttttctctttctacacaacttg---gccttaaacg
A0A8B9VI07_BMF-03       agtgtggtggcagctttttctctttctacacaacttg---gccttaaacg
                                 *  * *                               * * 

A0A8B9UZ84_PMAIP1-      tga-----------------------------------------------
A0A8B9VXZ3_BCL2L11      tggaggc-----gcgggtggttttga------------------------
A0A8B9VVW8_BCL2L11      tggt------ctgctgctgggttag-------------------------
A0A8B9VI07_BMF-02       tggctccaggcatcagccaagcaggctgctgcctgaggcagcaggctgcc
A0A8B9VI07_BMF-01       tggaggcgaacaggaaccacactgggcagag-------------------
A0A8B9VI07_BMF-03       tggaggcgaacaggaaccacactgggcagagccacagaaaggagggtctc
                        **                                                

A0A8B9UZ84_PMAIP1-      ---------
A0A8B9VXZ3_BCL2L11      ---------
A0A8B9VVW8_BCL2L11      ---------
A0A8B9VI07_BMF-02       agca-gtga
A0A8B9VI07_BMF-01       -----gtga
A0A8B9VI07_BMF-03       ttcctgtga
                                 

© 1998-2022Legal notice