Dataset for CDS classical BH3-containing proteins of organism Anas zonorhyncha

[Download (right click)] [Alignment] [Repertoires]

6 sequence(s)

>gnl|bcl2dbcds|A0A8B9UZ84_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Anas zonorhyncha GN=PMAIP1 (length=156 residues).
atgccgtgcaggaccctgcgcaaacctgcacaaccctccgcagaacggcaggcggtggcggagtgcgcgctggagctgcg
ccggatcggcgacaaggcggactttcgacagcggatcctgaacctcatcacaaagctgttctgccacaaaacgtga
>gnl|bcl2dbcds|A0A8B9VI07_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Anas zonorhyncha GN=BMF (length=582 residues).
atggatcgccccagctacctggaagaggactattctagcctggatgggctggacgatgacgtgtttcactctgatgactt
tggacttgcaggtcagcctggtgagatgactgcaacaggcattttcacacagaaccagtcctacagctgccttctgggga
ggtttcaactatttcccctcacacactgctgtggtcccggtgtcaggcatcctgagcagcaggacaaggcaactcaaaca
ctcagcccgtcctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccccggagactcttctatgggaa
tgctggttaccgtttacacgtccctccagttggctttgcattggatccacacctccaagaggagcctcaggaaggtcagc
aggaggcgcgtgctgaggtgcagattgcacggaagttgcagtgcattgcagaccagttccaccggctccacatacagagg
catcagcagaacagaaatcaagtgtggtggcagctttttctctttctacacaacttggccttaaacgtggaggcgaacag
gaaccacactgggcagaggtga
>gnl|bcl2dbcds|A0A8B9VI07_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Anas zonorhyncha GN=BMF (length=600 residues).
atggatcgccccagctacctggaagaggactattctagcctggatgggctggacgatgacgtgtttcactctgatgactt
tggacttgcaggtcagcctggtgagatgactgcaacaggcattttcacacagaaccagtcctacagctgccttctgggga
ggtttcaactatttcccctcacacactgctgtggtcccggtgtcaggcatcctgagcagcaggacaaggcaactcaaaca
ctcagcccgtcctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccccggagactcttctatgggaa
tgctggttaccgtttacacgtccctccagttggctttgcattggatccacacctccaagaggagcctcaggaaggtcagc
aggaggcgcgtgctgaggtgcagattgcacggaagttgcagtgcattgcagaccagttccaccggctccacatacagagg
gtagggtgtttccaaaggggaaggtgggggcttacttatccaggagtggtgctcctgaagcctggctccaggcatcagcc
aagcaggctgctgcctgaggcagcaggctgccagcagtga
>gnl|bcl2dbcds|A0A8B9VI07_BMF-03 Bcl2 modifying factor gene OS=[Eukaryota] Anas zonorhyncha GN=BMF (length=381 residues).
atggatcgccccagctacctggaagaggactattctagcctggatgggctggacgatgacgtgtttcactctgatgactt
tggacttgcagggaatgctggttaccgtttacacgtccctccagttggctttgcattggatccacacctccaagaggagc
ctcaggaaggtcagcaggaggcgcgtgctgaggtgcagattgcacggaagttgcagtgcattgcagaccagttccaccgg
ctccacatacagaggcatcagcagaacagaaatcaagtgtggtggcagctttttctctttctacacaacttggccttaaa
cgtggaggcgaacaggaaccacactgggcagagccacagaaaggagggtctcttcctgtga
>gnl|bcl2dbcds|A0A8B9VVW8_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Anas zonorhyncha GN=BCL2L11 (length=399 residues).
ctgcaccaggcagaagaaatacagccagaaatatggattgcacaggagctgcggcgcattggagatgaattcaatgcctc
ctattgtccaagaagggtaattttcttatttttactttccatttctttacacttagtctctaaaagggaaaagcttaatc
atatctggaaactagctctgcggcaagtgtttcgttcactcaaatgtagaaaaggatgcgcgggtggttgcattcacccg
ggtgcaggggcgtgctgcctgcgttgcggagttgcccgctgttgcagtgtcactaaacgcactcagagtcaccagcgagt
tgggaccggagacttccagttatcgcagctttgttcccagtaccaagagccagtaaagcatggtctgctgctgggttag
>gnl|bcl2dbcds|A0A8B9VXZ3_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Anas zonorhyncha GN=BCL2L11 (length=321 residues).
tcctcctcctcgccgtcgtcgtcgtcggccgccgcccggcccgtctctccctgcagcccgccgcgggctcagccgccgcc
cgccagccccggcccgttcgccacccgctcgccgctcttcatcttcgccgagcgcagccccgcgcccatgagctgcgaca
aggccacgcagacccccagcccgccctgccaggccgtcagccactacctgagcgccatgggtgacttaatgcaagtttca
caaccttgtgtagcaaacacacgtggcaccgccagacaaggatgctggagttgtgcagcatggaggcgcgggtggttttg
a
© 1998-2022Legal notice