Dataset for CDS classical BH3-containing proteins of organism Amphiprion ocellaris

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3Q1CI15_BCL2L11      ---cctac-----aaagtccggt-cctgacgcagcagcgcgctgcttcac
A0A3Q1CPU7_BAD-01       atggctgc-----aaaattcactatttcagacag-----------cgagt
A0A3Q1D1K3_BMF-01       atggacgatgaggaggatgatgtttttgagccagacccccactgctggcg
                                     *   *    *   * *  ***                

A0A3Q1CI15_BCL2L11      cagcggctccag-------------atgcagagac-------------tc
A0A3Q1CPU7_BAD-01       cagagccatcagaggaggtagaagagggagaaaacaaccattcaccagca
A0A3Q1D1K3_BMF-01       cacaacattcag-ggagat---aaagtgtgaagac---------cggggc
                        **       ***               *   * **               

A0A3Q1CI15_BCL2L11      agagaggcta-------------ccgccaaatccgtcccatggctcgccg
A0A3Q1CPU7_BAD-01       acacaagccatgcctgttttcgcccgccgcaac------atggc---ctt
A0A3Q1D1K3_BMF-01       acacagact---cctggtcctgcc--ctgcaaccaaacaacggcatgctg
                        * * *  *               *  *   * *      * ***   *  

A0A3Q1CI15_BCL2L11      gact------ccccgtcctggtccagagcgc-------aggccagcctag
A0A3Q1CPU7_BAD-01       acct--------------gaactcagaactccagcatctggtcggctcag
A0A3Q1D1K3_BMF-01       ccctgtggagtcgcagaggagcccagaccactcttctacggt-aacgcag
                          **                   **** * *        **    *  **

A0A3Q1CI15_BCL2L11      gcgtgtttcagaccaggtcgatttttcacctccctcgccgctcctccagt
A0A3Q1CPU7_BAD-01       gctgaactcgga------------gtcccacgcctccacgct-ctccaga
A0A3Q1D1K3_BMF-01       gtt---ttcgac------------tgcacttcccagcacgct-tt---ga
                        *      **                 * *   **    ****  *   * 

A0A3Q1CI15_BCL2L11      ggctatttctccgccgatggtgccgactcggtgccgagctccccgctctc
A0A3Q1CPU7_BAD-01       ga-----------------------------tgaggagctccaggcgagg
A0A3Q1D1K3_BMF-01       gcttat-------------------------tgggaatcaccaagcgagg
                        *                              **   * * **  **    

A0A3Q1CI15_BCL2L11      accgaagcgactgacggc--------tgacaaagc--cacgcagactccg
A0A3Q1CPU7_BAD-01       ggggaagaggaagccggcacgcccacagacggagctccgttcagggcacg
A0A3Q1D1K3_BMF-01       caacaaggaagtg-------------aaatggagc---------aaaatg
                            ***     *               *   ***              *

A0A3Q1CI15_BCL2L11      agcccgagcggccaggtgatcaaacacgcgctggagcgcatgaccgatga
A0A3Q1CPU7_BAD-01       gtccaagtcggct-------------ccccctgca---------ctgtgg
A0A3Q1D1K3_BMF-01       ggatggagcagct-------------gccccggcagc----aacctgtgg
                                * **                * * * *         *  ** 

A0A3Q1CI15_BCL2L11      ggcgcacggaggag---------gaccgggaacgcagcagcacggtgagc
A0A3Q1CPU7_BAD-01       gccgc--caagaag---tac---ggccagcagcttcgaaggatga-gcga
A0A3Q1D1K3_BMF-01       cacgcagcatggaggcttgcattggacagaaactccagctgatag-gaga
                          ***     * **         *  * * * *        *    * * 

A0A3Q1CI15_BCL2L11      tcaggctgaca---------------tacacgagggaaatcagttgcaca
A0A3Q1CPU7_BAD-01       tgagtttgacag------cctgcta-gataaaggggagatgaagagggtg
A0A3Q1D1K3_BMF-01       ccagtttcaccgggaacacctacaactgtatcatcgaaaccaaaggaacc
                          **  * **                   *     ** *  *   *    

A0A3Q1CI15_BCL2L11      ttcaatctctgcaatagtttttgcac------gctgttttctgtcactgt
A0A3Q1CPU7_BAD-01       aggag----tgcagggacagccagacagatgcaccactctaaaagctggt
A0A3Q1D1K3_BMF-01       aggggccgctgtggtggcgcctggccgca---gccgttctcag-------
                                 **              *       *   * *          

A0A3Q1CI15_BCL2L11      tttctgtcatcttcagtcgctgtttgcgtctacgctacaaaacgtcttga
A0A3Q1CPU7_BAD-01       ggagctacctctttagtcaccaggaga--------tggagggaga-----
A0A3Q1D1K3_BMF-01       --------ccttctgtttgacagggggttcattgctggaggaggt-----
                                   *    *        *         *  *    *      

A0A3Q1CI15_BCL2L11      ttaggtttattaacccaaactacttcagtacattttgga------acaga
A0A3Q1CPU7_BAD-01       ----------------gaacaaccaccatgaaagccacacacatcgcaat
A0A3Q1D1K3_BMF-01       ----------------g----------gtgcaggacgga-----------
                                                    *  *      *           

A0A3Q1CI15_BCL2L11      tgttaa
A0A3Q1CPU7_BAD-01       gagtag
A0A3Q1D1K3_BMF-01       -ggtga

© 1998-2022Legal notice