Dataset for CDS BCL2L11 of organism Ailuropoda melanoleuca

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      ------------------------------------------atggggcc
A0A7N5JE15_BCL2L11      ccggccacttggggcggcgggagccgccaaggctcgcgcggcgtccgggc
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      ---------------------------acacgctcggctggggcagggcc
A0A7N5JE15_BCL2L11      --------------------------------------------------
                                                                          

A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      ggagtggggaacgcggccagccg---------------------------
A0A7N5JE15_BCL2L11      cgggacagaggcggggcgggcagggggagccggggcagctcgggtccgcg
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      ggcagcaagcgcgggggaacccggccgggccaccctcgcctttacctgtt
A0A7N5JE15_BCL2L11      --------------------------------------------------
                                                                          

A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      -----cctgcaatcgctgcatctgcgcccgc-------------------
A0A7N5JE15_BCL2L11      agactcccgccgcggtcgcagccggggccgccttcggaggcgagtttgtc
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      ggagcctgaaagcgccagcggctgcggctgc-------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
                                                                          

A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      aacaatcgcctcgcctttggcggcctgacccgtaggcgccgcctccgccg
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
                                                                          

A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------tcctgtgctccagcgcagtatctgatcccg
A0A7N5JE15_BCL2L11      gcggcggctattggctgtggcgcggagcgaccgcgcacgggccaattggg
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      ------------ggctgcggcgcggcggggcggggcggggcgtgcttgcc
A0A7N5JE15_BCL2L11      --------------------------------------------------
                                                                          

A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      gg------------------------------------------------
A0A7N5JE15_BCL2L11      agcgcgggcacccggcgccagcggcgcggggaggtcggcggtgccggcgg
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      cgcgcgccggggcgggacttagagggggcggagctcgcggtgattgg---
A0A7N5JE15_BCL2L11      --------------------------------------------------
                                                                          

A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      cggcgggcgcagtgcgcgaggaggagcgggaggancgcggaggccctcgg
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      ------------------------------------gtgagagccctcgg
A0A7N5JE15_BCL2L11      --------------------------------------------------
                                                                          

A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      ----aagtcagagcccgctgggagtttccgacttctgcaagtcggctctg
A0A7N5JE15_BCL2L11      ctgcccggcggagcgcggcggcggg--cgggcggccagtggccggctctg
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      ccgccagtctgagctgagctgcggggctgtgcaggtttcacttcgctcgg
A0A7N5JE15_BCL2L11      --------------------------------------------------
                                                                          

A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      agc-----------------------------------------------
A0A7N5JE15_BCL2L11      cgctgccccgggggctctg-----------------aacgcgagtcccgg
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      cgcagcctccaagtcttggtcttgtgaaagcgctccgtcctgcgtcgccg
A0A7N5JE15_BCL2L11      --------------------------------------------------
                                                                          

A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      gtattgtctcctgcgctcccttcgtgctgacggtcagggggctccgggtc
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      ctgccaccgctgccaccggattctcacagtcaccctgcgcgcgccagccc
A0A7N5JE15_BCL2L11      --------------------------------------------------
                                                                          

A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      ggcgaaggacgcgggcaggacgccgcggggcccgggcccgggcccggacg
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      aactgcggccagcatcgccgcgggctgctcgcttcgccccgctcccgccg
A0A7N5JE15_BCL2L11      --------------------------------------------------
                                                                          

A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      cgacgatcg-----------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      ccaccccctcggcgccctttccctggccctcgtccccccaatgtctgact
A0A7N5JE15_BCL2L11      --------------------------------------------------
                                                                          

A0A7N5JE15_BCL2L11      ---------------------------------------atggcaaagca
A0A7N5JE15_BCL2L11      ---------------------------------------atggcaaagca
A0A7N5JE15_BCL2L11      ---------------aaagagcacataaaaaaagaccaaatggcaaagca
A0A7N5JE15_BCL2L11      ---------gaagggaaggggcggacaaaaaaagaccaaatggcaaagca
A0A7N5JE15_BCL2L11      ---------------------------------------atggcaaagca
A0A7N5JE15_BCL2L11      ctgactctcggactgagaaacgcaagaaaaaaagaccaaatggcaaagca
A0A7N5JE15_BCL2L11      ---------------------------------------atggcaaagca
                                                               ***********

A0A7N5JE15_BCL2L11      accttcagatgtaagttctgagtgtgacagagaaggtggacaactgcagc
A0A7N5JE15_BCL2L11      accttcagatgtaagttctgagtgtgacagagaaggtggacaactgcagc
A0A7N5JE15_BCL2L11      accttcagatgtaagttctgagtgtgacagagaaggtggacaactgcagc
A0A7N5JE15_BCL2L11      accttcagatgtaagttctgagtgtgacagagaaggtggacaactgcagc
A0A7N5JE15_BCL2L11      accttcagatgtaagttctgagtgtgacagagaaggtggacaactgcagc
A0A7N5JE15_BCL2L11      accttcagatgtaagttctgagtgtgacagagaaggtggacaactgcagc
A0A7N5JE15_BCL2L11      accttcagatgtaagttctgagtgtgacagagaaggtggacaactgcagc
                        **************************************************

A0A7N5JE15_BCL2L11      ctgctgagaggcctcctcagctcaggcctggggcccctacctctctacag
A0A7N5JE15_BCL2L11      ctgctgagaggcctcctcagctcaggcctggggcccctacctctctacag
A0A7N5JE15_BCL2L11      ctgctgagaggcctcctcagctcaggcctggggcccctacctctctacag
A0A7N5JE15_BCL2L11      ctgctgagaggcctcctcagctcaggcctggggcccctacctctctacag
A0A7N5JE15_BCL2L11      ctgctgagaggcctcctcagctcaggcctggggcccctacctctctacag
A0A7N5JE15_BCL2L11      ctgctgagaggcctcctcagctcaggcctggggcccctacctctctacag
A0A7N5JE15_BCL2L11      ctgctgagaggcctcctcagctcaggcctggggcccctacctctctacag
                        **************************************************

A0A7N5JE15_BCL2L11      acagagcagcaaggtaatcctgaaggcgaaggggaccgctgcccccaagg
A0A7N5JE15_BCL2L11      acagagcagcaaggtaatcctgaaggcgaaggggaccgctgcccccaagg
A0A7N5JE15_BCL2L11      acagagcagca---------------------------------------
A0A7N5JE15_BCL2L11      acagagcagca---------------------------------------
A0A7N5JE15_BCL2L11      acagagcagca---------------------------------------
A0A7N5JE15_BCL2L11      acagagcagca---------------------------------------
A0A7N5JE15_BCL2L11      acagagcagca---------------------------------------
                        ***********                                       

A0A7N5JE15_BCL2L11      cagccctcagggcccgctggccccaccagccagcccaggcccttttgcta
A0A7N5JE15_BCL2L11      cagccctcagggcccgctggccccaccagccagcccaggcccttttgcta
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
                                                                          

A0A7N5JE15_BCL2L11      ccagatccccgcttttcatctttgtgagaagatcctccctgctgtctcga
A0A7N5JE15_BCL2L11      ccagatccccgcttttcatctttgtgagaagatcctccctgctgtctcga
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
                                                                          

A0A7N5JE15_BCL2L11      tcctccagtgggtatttctcttttgacacagacaggagcccggcacccat
A0A7N5JE15_BCL2L11      tcctccagtgggtatttctcttttgacacagacaggagcccggcacccat
A0A7N5JE15_BCL2L11      -----------------------------agacaggagcccggcacccat
A0A7N5JE15_BCL2L11      -----------------------------agacaggagcccggcacccat
A0A7N5JE15_BCL2L11      -----------------------------agacaggagcccggcacccat
A0A7N5JE15_BCL2L11      -----------------------------agacaggagcccggcacccat
A0A7N5JE15_BCL2L11      -----------------------------a--------------------
                                                     *                    

A0A7N5JE15_BCL2L11      gagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttca
A0A7N5JE15_BCL2L11      gagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttca
A0A7N5JE15_BCL2L11      gagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttca
A0A7N5JE15_BCL2L11      gagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttca
A0A7N5JE15_BCL2L11      gagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttca
A0A7N5JE15_BCL2L11      gagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttca
A0A7N5JE15_BCL2L11      --------------------------------------------------
                                                                          

A0A7N5JE15_BCL2L11      accattatctcagtgcaatggcttccatgaggcagtctcaggctgtacct
A0A7N5JE15_BCL2L11      accattatctcagtgcaatggcttccatgaggcagtctcaggctgtacct
A0A7N5JE15_BCL2L11      accattatctcagtgcaatggcttccatgaggcagtctcaggctgtacct
A0A7N5JE15_BCL2L11      accattatctcagtgcaatggcttccatgaggcagtctcaggctgtacct
A0A7N5JE15_BCL2L11      accattatctcagtgcaatggcttccatgaggcagtctcaggctgtacct
A0A7N5JE15_BCL2L11      accattatctcagtgcaatggcttccatgaggcagtctcaggctgtacct
A0A7N5JE15_BCL2L11      --------------------gcttccatgaggcagtctcaggctgtacct
                                            ******************************

A0A7N5JE15_BCL2L11      gccgatatgcgcccggagatatggattgcgcaagagttgcggcgtattgg
A0A7N5JE15_BCL2L11      gccgatatgcgcccggagatatggattgcgcaagagttgcggcgtattgg
A0A7N5JE15_BCL2L11      gccgatatgcgcccggagatatggattgcgcaagagttgcggcgtattgg
A0A7N5JE15_BCL2L11      gccgatatgcgcccggagatatggattgcgcaagagttgcggcgtattgg
A0A7N5JE15_BCL2L11      gccgatatgcgcccggagatatggattgcgcaagagttgcggcgtattgg
A0A7N5JE15_BCL2L11      gccgatatgcgcccggagatatggattgcgcaagagttgcggcgtattgg
A0A7N5JE15_BCL2L11      gccgatatgcgcccggagatatggattgcgcaagagttgcggcgtattgg
                        **************************************************

A0A7N5JE15_BCL2L11      agacgaatttaatgcatattacccaaggagggtctttctgaataattacc
A0A7N5JE15_BCL2L11      agacgaatttaatgcatattacccaaggaggtt-----------------
A0A7N5JE15_BCL2L11      agacgaatttaatgcatattacccaaggagggtctttctgaataattacc
A0A7N5JE15_BCL2L11      agacgaatttaatgcatattacccaaggagggtctttctgaataattacc
A0A7N5JE15_BCL2L11      agacgaatttaatgcatattacccaaggaggggct---tggttgctgcgg
A0A7N5JE15_BCL2L11      agacgaatttaatgcatattacccaaggagggtctttctgaataattacc
A0A7N5JE15_BCL2L11      agacgaatttaatgcatattacccaaggagg------------------c
                        *******************************                   

A0A7N5JE15_BCL2L11      aagcagccgaagc-------------------------------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      aagcagccgaagc-------------------------------------
A0A7N5JE15_BCL2L11      aagcagccgaagc-------------------------------------
A0A7N5JE15_BCL2L11      gagcagctgactcaggactcccacggatagctccagaaacgtgtggcccg
A0A7N5JE15_BCL2L11      aagcagccgaagc-------------------------------------
A0A7N5JE15_BCL2L11      tggcaa--gaatt-------------------------------------
                                                                          

A0A7N5JE15_BCL2L11      -------------------------ccacccccaaa--------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      -------------------------ccacccccaaa--------------
A0A7N5JE15_BCL2L11      -------------------------ccacccccaaa--------------
A0A7N5JE15_BCL2L11      tggcagcgtcacgggatcaagtgcaccagccccgggaggaacgtgctgaa
A0A7N5JE15_BCL2L11      -------------------------ccacccccaaa--------------
A0A7N5JE15_BCL2L11      -------------------------ccagc--------------------
                                                                          

A0A7N5JE15_BCL2L11      -------------------------tgattatc-----------------
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      -------------------------tgattatc-----------------
A0A7N5JE15_BCL2L11      -------------------------tgattatc-----------------
A0A7N5JE15_BCL2L11      ggacagcgctcagtcaggtaccttctgtttgtctaaattgtgttgtagtt
A0A7N5JE15_BCL2L11      -------------------------tgattatc-----------------
A0A7N5JE15_BCL2L11      ------------------------------atc-----------------
                                                                          

A0A7N5JE15_BCL2L11      ------------------------ttgcgactgttacgttacatcgtc--
A0A7N5JE15_BCL2L11      --------------------------------------------------
A0A7N5JE15_BCL2L11      ------------------------ttgcgactgttacgttacatcgtc--
A0A7N5JE15_BCL2L11      ------------------------ttgcgactgttacgttacatcgtc--
A0A7N5JE15_BCL2L11      gcaaaatgttcaatcctcatttgtttccccctgtcagtttgcgctggcac
A0A7N5JE15_BCL2L11      ------------------------ttgcgactgttacgttacatcgtc--
A0A7N5JE15_BCL2L11      ------------------------ctacctctgc----------------
                                                                          

A0A7N5JE15_BCL2L11      ---------cgcctggtgtggagattgcagcga
A0A7N5JE15_BCL2L11      ---------------------aga--gcaatag
A0A7N5JE15_BCL2L11      ---------cgcctggtgtggagattgcagtga
A0A7N5JE15_BCL2L11      ---------cgcctggtgtggagattgcagtga
A0A7N5JE15_BCL2L11      tggcattcacgtctcctgccaaatttggggtga
A0A7N5JE15_BCL2L11      ---------cgcctggtgtggagattgcagtga
A0A7N5JE15_BCL2L11      ---------------------------------
                                                         

© 1998-2022Legal notice