Dataset for CDS BCL2L11 of organism Ailuropoda melanoleuca

[Download (right click)] [Alignment] [Repertoires]

7 sequence(s)

>gnl|bcl2dbcds|A0A7N5JE15_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BCL2L11 (length=573 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaactgcagcctgctgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagagcagcaagacaggagcccggcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctcaggctgta
cctgccgatatgcgcccggagatatggattgcgcaagagttgcggcgtattggagacgaatttaatgcatattacccaag
gaggggcttggttgctgcgggagcagctgactcaggactcccacggatagctccagaaacgtgtggcccgtggcagcgtc
acgggatcaagtgcaccagccccgggaggaacgtgctgaaggacagcgctcagtcaggtaccttctgtttgtctaaattg
tgttgtagttgcaaaatgttcaatcctcatttgtttccccctgtcagtttgcgctggcactggcattcacgtctcctgcc
aaatttggggtga
>gnl|bcl2dbcds|A0A7N5JE15_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BCL2L11 (length=915 residues).
acacgctcggctggggcagggccggcagcaagcgcgggggaacccggccgggccaccctcgcctttacctgttggagcct
gaaagcgccagcggctgcggctgcggctgcggcgcggcggggcggggcggggcgtgcttgcccgcgcgccggggcgggac
ttagagggggcggagctcgcggtgattgggtgagagccctcggccgccagtctgagctgagctgcggggctgtgcaggtt
tcacttcgctcggcgcagcctccaagtcttggtcttgtgaaagcgctccgtcctgcgtcgccgctgccaccgctgccacc
ggattctcacagtcaccctgcgcgcgccagcccaactgcggccagcatcgccgcgggctgctcgcttcgccccgctcccg
ccgccaccccctcggcgccctttccctggccctcgtccccccaatgtctgactctgactctcggactgagaaacgcaaga
aaaaaagaccaaatggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaactgcagcctgctga
gaggcctcctcagctcaggcctggggcccctacctctctacagacagagcagcaagacaggagcccggcacccatgagtt
gtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcag
tctcaggctgtacctgccgatatgcgcccggagatatggattgcgcaagagttgcggcgtattggagacgaatttaatgc
atattacccaaggagggtctttctgaataattaccaagcagccgaagcccacccccaaatgattatcttgcgactgttac
gttacatcgtccgcctggtgtggagattgcagtga
>gnl|bcl2dbcds|A0A7N5JE15_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BCL2L11 (length=993 residues).
ccggccacttggggcggcgggagccgccaaggctcgcgcggcgtccgggccgggacagaggcggggcgggcagggggagc
cggggcagctcgggtccgcgagactcccgccgcggtcgcagccggggccgccttcggaggcgagtttgtcaacaatcgcc
tcgcctttggcggcctgacccgtaggcgccgcctccgccggcggcggctattggctgtggcgcggagcgaccgcgcacgg
gccaattgggagcgcgggcacccggcgccagcggcgcggggaggtcggcggtgccggcggcggcgggcgcagtgcgcgag
gaggagcgggaggancgcggaggccctcggctgcccggcggagcgcggcggcgggcgggcggccagtggccggctctgcg
ctgccccgggggctctgaacgcgagtcccgggtattgtctcctgcgctcccttcgtgctgacggtcagggggctccgggt
cggcgaaggacgcgggcaggacgccgcggggcccgggcccgggcccggacgcgacgatcggaagggaaggggcggacaaa
aaaagaccaaatggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaactgcagcctgctgaga
ggcctcctcagctcaggcctggggcccctacctctctacagacagagcagcaagacaggagcccggcacccatgagttgt
gacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtc
tcaggctgtacctgccgatatgcgcccggagatatggattgcgcaagagttgcggcgtattggagacgaatttaatgcat
attacccaaggagggtctttctgaataattaccaagcagccgaagcccacccccaaatgattatcttgcgactgttacgt
tacatcgtccgcctggtgtggagattgcagtga
>gnl|bcl2dbcds|A0A7N5JE15_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BCL2L11 (length=585 residues).
atggggccggagtggggaacgcggccagccgcctgcaatcgctgcatctgcgcccgctcctgtgctccagcgcagtatct
gatcccgggaagtcagagcccgctgggagtttccgacttctgcaagtcggctctgagcaaagagcacataaaaaaagacc
aaatggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaactgcagcctgctgagaggcctcct
cagctcaggcctggggcccctacctctctacagacagagcagcaagacaggagcccggcacccatgagttgtgacaaatc
aacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctcaggctg
tacctgccgatatgcgcccggagatatggattgcgcaagagttgcggcgtattggagacgaatttaatgcatattaccca
aggagggtctttctgaataattaccaagcagccgaagcccacccccaaatgattatcttgcgactgttacgttacatcgt
ccgcctggtgtggagattgcagtga
>gnl|bcl2dbcds|A0A7N5JE15_BCL2L11-05 BCL2-like 11 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BCL2L11 (length=591 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaactgcagcctgctgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagagcagcaaggtaatcctgaaggcgaaggggaccgctgcccccaag
gcagccctcagggcccgctggccccaccagccagcccaggcccttttgctaccagatccccgcttttcatctttgtgaga
agatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctc
aggctgtacctgccgatatgcgcccggagatatggattgcgcaagagttgcggcgtattggagacgaatttaatgcatat
tacccaaggagggtctttctgaataattaccaagcagccgaagcccacccccaaatgattatcttgcgactgttacgtta
catcgtccgcctggtgtggagattgcagcga
>gnl|bcl2dbcds|A0A7N5JE15_BCL2L11-06 BCL2-like 11 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BCL2L11 (length=504 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaactgcagcctgctgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagagcagcaaggtaatcctgaaggcgaaggggaccgctgcccccaag
gcagccctcagggcccgctggccccaccagccagcccaggcccttttgctaccagatccccgcttttcatctttgtgaga
agatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctc
aggctgtacctgccgatatgcgcccggagatatggattgcgcaagagttgcggcgtattggagacgaatttaatgcatat
tacccaaggaggttagagcaatag
>gnl|bcl2dbcds|A0A7N5JE15_BCL2L11-07 BCL2-like 11 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BCL2L11 (length=264 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaactgcagcctgctgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagagcagcaagcttccatgaggcagtctcaggctgtacctgccgata
tgcgcccggagatatggattgcgcaagagttgcggcgtattggagacgaatttaatgcatattacccaaggaggctggca
agaattccagcatcctacctctgc
© 1998-2022Legal notice