Dataset for CDS Unclassified of organism Teiidae poxvirus 1

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A894ZZZ8_uncFPV039-01 Putative FPV039 gene OS=[Viruses] Teiidae poxvirus 1 (length=531 residues).
atgcagtcttctatagaaagaggtcctaagtacactcttttatacgatgttattaacaactattgtacggagtatgtaac
cggcatgtccagaatgaaatacgtaaaagataaggaagcgtacgaatgcgtcaagctgatttgcgagtttgttatccaac
aaaacgaaaaacaatttaagcatttcctaaaaaatgtaagatctcagagacgtatcagtagcatctttaattccatgatc
gaagattgtatcaattggggaagagttatggttatgatagccttcacagcttacgctgttaaatactttacagaaaatga
cataaatatggaagaagatttaaccgtcgtagtaactgatatcctttcatccaaatacggcgcgtggttcgaggtagaag
gttattggaaaggaatacgcactcataaaaataacattaaaagatttcaaaccttaaaaaatatcataaaagtatctatg
tttgttattgcaactttagtcatcgtacgattctgctttttattaatctag
© 1998-2022Legal notice