Dataset for CDS Unclassified of organism Mudlarkpox virus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A891M0E3_uncFPV039-01 Putative FPV039 gene OS=[Viruses] Mudlarkpox virus (length=528 residues).
atggatccttccgttaaaaaagacgaaatatactacacaattttaaacattatacagaattactttatagaatattgtac
aggtaaaaacaggaactttcacgtagaagatgaaaatacttacattatagttaaaaatatgtgcgatatcattttaagag
ataatatcgttgagtttagaaaagatattgatagatgcagtgatatagaaaatgagattccagaaatagtgtatgatact
atacatgataagattacatggggaagagtaatcagcataatagcgttcggtgcatatgttacaaaggtatttaaagagaa
aggtagagataatgtagtagatcttatgcctgatataataacagaatcactattatctaggtgtagatcgtggttatcag
atcagaattgttgggacggattaaaggcgtacgtttataataataagaaattttattatgttacacgttattttagagcc
gctgcatttataattacgtcattagcagttattaacttgtttttgtag
© 1998-2022Legal notice