Dataset for CDS 097R of organism Stickleback virus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8F9RB68_097R-01 097R gene OS=[Viruses] Stickleback virus GN=097R (length=414 residues).
atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggtggccctgagggccgccgcggacgccgtggg
agtagacaacagggcctgcgcccacctatacaccatgctgtgggaaggcgtcaacctggaggaggttcacgcatccctcc
tgggagacggcgttgtaaactggggcagggtggccgcgtttatgcacatctgcaggtacatcgtcaggacctttccgtcc
agcatggatagaacagaggttgctctgactaaatttatacaggacccaaagatagacaagcaactcagagagtggacaga
taggctgggtacagtcggggtgattgggagatgcttagagtggttgggagcgggagtgatcactggagtggtcctatctc
tcttgttctattga
© 1998-2022Legal notice