Dataset for CDS Unclassified of organism Oryzias sinensis

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8C7YAE9_unc070L-01 Putative 070L gene OS=[Eukaryota] Oryzias sinensis (length=591 residues).
gtcccagtgacacggagcctacagagagagcctttgtgcacggacagtgatgaaatgaaatatcagtcacctaggttgaa
ttcaaagtcacctaggcttgcttgtagctttgttgtttgtttggttttctcctcatacagctttttatttacccccctct
gtgatcaaagagaaaatcatcgggctttgcgatttgaggagcagagctcacagcacaaacagatctatctaggtgattca
tttcccgatgccgcgatggtcaacgtagcgaaaagccttttcgaggacgggatcatcaactggggccgtgtggtcagtct
gatatgtttgggagccgcggtgtgccaacatcaggacaggttcagtggcagccctggctccctcttggctgacacagtgt
cagaggcgatcgcctcgtacttgctcacagagcacagaggctggctggaagagatgtgttgggtgagtggcctgtactct
aggggggttgaacttcatgctatcgctgttatgaaacaatttgtcttcatgttttgctttttttttttttctgttcctct
ttctgttctttttttaacgctttcttcatga
© 1998-2023Legal notice