Dataset for CDS Unclassified of organism Frog virus 3

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A5B8P2Y9_unc097R-01 Putative 097R gene OS=[Viruses] Frog virus 3 (length=210 residues).
atggtggccctgagggccgccgcggacgccgtgggagtagacaacagggcctgcgcccacctatacaccatgctgtggga
aggcgtcaacctggaggaggttcacgcatccctcctgggagacggcgttgtaaactggggtagggtggccgcgtttatgc
acatctgcaggtacatcgtcaggacctttccgggacagaggttgctctga
© 1998-2020Legal notice