Dataset for CDS Unclassified of organism Clytia hemisphaerica

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A7M5X572_unc070L-01 Putative 070L gene OS=[Eukaryota] Clytia hemisphaerica (length=537 residues).
atgtcaccagctcgtacagatttgatcgtagatggggagttttaccaaaggacgaaattcctggcaaattatgtgctgaa
gaaacatcataatcatacgcaaagaactgatagaatcggggataaactttatgaactatgtcttgatattaaatataagc
atgatatgttttttgaaaatgtaggacgtgaacttgggttaaatcaagagaattttgatgaactttctaaagctgttatg
gcagaagtactaaatggaaattgtaactttggtcgtattgtatcaatctatgcattcagcttagcgctttcagattattg
tatcaaaaataacttaggagataaaacagaaagtattacaacaaatgtagcattatccatacaagaacacattgaatggt
ttaataaccatggtcaatgggacggttttttagaccacttcacaccacaaactgtagaagacaaagtttggcgtggaatg
atgatcacgacctttggactaggagctgttgcagggcttatatatgctcattcataa
© 1998-2022Legal notice