Dataset for CDS vNR13 of organism Varanus komodoensis

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8D2LWG1_vNR13-01 vNR13 gene OS=[Eukaryota] Varanus komodoensis GN=vNR13 (length=537 residues).
atgccgggcgcgctgcgcgaggagacggcgcagctgctggccgactacttccagcaccggctgggggccgcggcgctgcc
gcccagccgcacggccgagacgctgcgccgggtggccgacgagctggagagccgcgagcggccgttcttccgcgacgcct
gcggcgcggcggccgcggcggagccgggcgaggcggccgcgctgctgggccgggtggcggcgcagatggaggcggagggc
ggcctcaactggggccgggtggtggcgctggtcgtgttcgccgggaacctggcggcggcgctggccgagcgcggagctcg
cgacgagacgggcgcgctggtggaggcgctggccgcctacttggccggggagaagcgcgagtggctggaggcgcacggcg
gctgggatggcttctaccacttcttcaataagcatgactcggatgcagctgaccagagcagcaccataagcaatgccatc
atggcagcggcagggttcggtctggcgggattggctttcctcttggccgtgcgatag
© 1998-2022Legal notice